The genetic analysis of a founder Northern American population of European descent identifies FANCI as a candidate familial ovarian cancer risk gene

Caitlin T Fierheller, Laure Guitton-Sert, Wejdan M Alenezi, Timothée Revil, Kathleen K Oros, Karine Bedard, Suzanna L Arcand, Corinne Serruya, Supriya Behl, Liliane Meunier, Hubert Fleury, Eleanor Fewings, Deepak N Subramanian, Javad Nadaf, Diane Provencher, William D Foulkes, Zaki El Haffaf, Anne-Marie Mes-Masson, Jacek Majewski, Marc Tischkowitz, Paul A James, Ian G Campbell, Celia M T Greenwood, Jiannis Ragoussis, Jean-Yves Masson, Patricia N Tonin
doi: https://doi.org/10.1101/2020.05.04.20090407

Abstract

Some familial ovarian cancer (OC) could be due to rare risk alleles in genes that each account for a relatively small proportion of cases not due to BRCA1 and BRCA2, major risk genes in the homologous recombination (HR) DNA repair pathway. We report a new candidate OC risk allele, FANCI c.1813C>T in a Fanconi anemia (FA) gene that plays a role upstream of the HR DNA repair pathway. This variant was identified by whole exome sequencing of a BRCA1 and BRCA2 mutation-negative French Canadian (FC) OC family from a population exhibiting founder effects. In FCs, the c.1813C>T allele was detected in 7% (3/43) of familial and 1.6% (7/439) of sporadic OC cases; and in 3.7% (3/82) of familial breast cancer (BC) cases with a family history of OC and in 1.9% (3/158) of BC only families. This allele was significantly associated with FC BRCA1 and BRCA2 mutation-negative OC families (OR=5.6; 95%CI=1.6-19; p=0.006). Although FANCI c.1813C>T was detected in 2.5% (74/2950) of cancer-free FC females, carriers had a personal history of known OC risk reducing factors, and female/male carriers were more likely to have reported a first-degree relative with OC (ρ=0.037; p=0.011). Eight rare potentially pathogenic FANCI variants were identified in 3.3% (17/516) of Australian OC cases, including 10 carriers of FANCI c.1813C>T. Potentially pathogenic FANCI variants were significantly more common in AUS OC cases with a family history of OC than in isolated OC cases (p=0.027). The odds ratios (OR) were >3 for carriers of any of the seven rarest FANCI alleles, and 1.5 for c.1813C>T. Data from the OC Association Consortium revealed that the ORs for the c.1813C>T allele were highest for the most common OC subtypes. Localization of FANCD2, part of the FANCI-FANCD2 (ID2) binding complex in the FA pathway, to sites of induced DNA damage was severely impeded in cells expressing the p.L605F isoform. This isoform was expressed at a reduced level; unstable by formaldehyde or mitomycin C treatment; and exhibited sensitivity to cisplatin but not to olaparib (a poly [ADP-ribose] polymerase inhibitor). By tissue microarray analyses, FANCI protein was robustly expressed in fallopian tube epithelial cells but expressed at low-to-moderate levels in 88% (83/94) of high-grade serous carcinoma OC samples. This is the first study to describe potentially pathogenic variants in OC in a member of the ID2 complex of the FA DNA repair pathway. Our data suggest that potentially pathogenic FANCI variants may modify OC risk in cancer families.

Ovarian cancer (OC), with an overall five-year survival rate of 40%, is the leading cause of death in women with gynecologic cancen. The overall lifetime risk for OC in the North American population is 1.3%1. However, twin studies suggest that 22% of OC risk can be attributed to heritable factors2 and having an affected first-degree relative confers a 3-7 fold increase in risk to this disease3,4. Carriers that are heterozygous for pathogenic variants in BRCA1 (FANCS) or BRCA2 (FANCD1) have an estimated lifetime risk for OC of 17-44% (by age 80 years), depending on the gene mutated5. Pathogenic BRCA1 and BRCA2 variants have been reported in 65-85% of cancer syndromes featuring high-grade serous carcinoma (HGSC)6 - the most common histopathological subtype of epithelial OC7 - and/or young age (<50 years) of onset breast cancer (BC), and in 10-20% of HGSC cases regardless of age at diagnosis8. Identifying carriers of BRCA1 and BRCA2 pathogenic variants for cancer prevention (prophylactic surgery9,10) and increasingly, management of OC using new therapies (poly [ADP-ribose] polymerase inhibitors [PARPi]11-16) has been offered in medical genetic and gynecologic oncology settings.

New cancer predisposing gene (CPG) candidates have been investigated with a focus on members of the Fanconi anemia (FA) DNA repair pathway involving BRCA1 and BRCA2 function. An early study of 429 women with HGSC reported that 20% are carriers of heterozygous loss of function (LoF) variants in FA pathway genes, though their association with heritable risk was not investigated17. The most promising new OC predisposing genes are from reports of heterozygous carriers of potentially pathogenic variants in BRIP1 (FANCJ)18,19, RAD51C (FANCO)20-23, and RAD51D24. In cancer families carriers of pathogenic RAD51C and RAD51D variants have been estimated to have cumulative risks to age 80 of 11% (95%CI 6-21) and 13% (95%CI 7-23), respectively, for OC25. Collectively, carriers of pathogenic variants in these genes have not accounted for a large proportion of familial OC and BC cases that have not been attributed to the known CPGs. Therefore, it is possible that new CPGs conferring risk to OC have yet to be discovered.

The low incidence of OC, rarity of pathogenic variants in each proposed CPG candidate, and genetic heterogeneity of the general population pose major challenges in finding new OC predisposing genes. An attractive strategy for gene discovery focuses on the investigation of demographically (ethnically/geographically) defined populations that take advantage of founder effects. Due to common ancestry, rapid expansion and geographic isolation during 1608~1760 of the small founding immigrant French population of Quebec from Europe (EUR), a loss of genetic variation has occurred resulting in subsequent waves of expansion of specific variants26-29. As French Canadians (FC) are more likely to harbour recurrent germline pathogenic variants, candidate variants are readily identified by sequencing familial cases and/or by comparing allele frequencies in cancer cases versus cancer-free controls in contrast to studies involving the general population due to allelic heterogeneity26,27. Though 19 different pathogenic BRCA1 or BRCA2 variants have been identified in FC cancer families of Quebec, five recurrent pathogenic variants account for 84% of all mutation-positive BC and/or OC families30. This is in contrast to the over two thousand different pathogenic BRCA1 and BRCA2 variants reported for undefined populations31. Specific recurrent pathogenic variants in PALB2 (FANCN - c.2323C>T; p.Q775X)32 and RAD51D (c.620C>T; p.S207L)33 have since been identified in BC and HGSC cases of FC descent, respectively.

Using whole exome sequencing (WES) analyses, we identified heterozygous carriers of FANCI c.1813C>T; p.L605F missense variant among OC affected sisters in a BRCA1 and BRCA2 mutation-negative four-case OC family of FC descent. We pursued this variant as a candidate OC risk allele as it occurred in the FA Complementation Group I gene which is purported to play a role upstream of the homologous recombination (HR) DNA repair pathway involving BRCA1 and BRCA2 function34-36. Also, FANCI is an essential member of the FA-HR DNA repair pathway and acts as the molecular switch to activate this pathway37. In response to DNA damage, FANCI and its heterodimeric binding partner FANCD2, which form the ID2 complex, are monoubiquitinated and localized to sites of DNA damage allowing for the recruitment of other DNA repair proteins34-36,38.

To evaluate the potential pathogenicity of FANCI c.1813C>T; p.L605F, we applied a genetic strategy that took advantage of founder effects in the FC population by investigating its allele frequency in FC OC and cancer-free subjects. We applied various in vitro experiments to investigate the effects of the encoded p.L605F isoform on FANCI protein function and response to chemotherapies used in the treatment of OC. We also investigated FANCI expression in HGSC and normal tissues. Then, based on our findings from these studies, we investigated other populations, specifically Canadian non-FC (CDN) and Australia (AUS) familial cancer cases for rare potentially pathogenic FANCI variants.

Results

Discovery of FANCI c.1813C>T as a candidate OC predisposing variant

We previously reported a rare BRCA1 and BRCA2 mutation-negative four-case OC family (F1528) in a study of the histopathology of OC and BRCA1 and BRCA2 pathogenic variant carrier status of FC cancer families39. To investigate if other potentially pathogenic variants could be contributing to cancer risk in this family, WES and bioinformatic analyses were performed on peripheral blood lymphocyte (PBL) DNA available from two affected siblings both of whom had HGSC39. We selected rare (variant allele frequency [VAF] <1%) potentially pathogenic variants as candidates that were inherited in the heterozygous state and shared in common with the affected sisters. FANCI c.1813C>T was among the list of rare variants shared by the affected sisters. This was an intriguing candidate to investigate given that family F1528 is predicted to harbour a pathogenic variant in BRCA1 or BRCA2 (Manchester score40,41: BRCA1=29, BRCA2=20), genes which are involved in the FA-HR pathway. FANCI, which plays a role in this pathway, may be associated with phenotypically similar cancer families39,42 (Figure 1). The C>T nucleotide alteration is predicted to result in a leucine to phenylalanine change affecting a highly conserved amino acid residue at position 605 (Genomic Evolutionary Rate Profiling [GERP++]43 score = 6.1) that resides in the S/TQ phosphorylation cluster37. It is also predicted to be “probably damaging” (PolyPhen244 score = 1.0). However at the time of discovery, the overall allele frequency of FANCI c.1813C>T from available databases was 0.76% in the National Heart, Lung and Blood Institute (NHLBI) Exome Sequencing Project (ESP) v.2014 (https://evs.gs.washington.edu/EVS/) and 0.2% in the 1000 Genomes Project45. These allele frequencies were notably higher than expected for individual pathogenic variants found in known OC predisposing genes, such as BRCA1 and BRCA2 (0.001%). Therefore, we performed a molecular investigation before pursuing extensive genetic analyses of our study groups.

Figure 1.
Figure 1.

Study design for investigation of FANCI variants. A) Pedigree of a rare four-case FC OC family F1528 where FANCI c.1813C>T; p.L605F was discovered (top). Cancer type (ovarian [Ov], fallopian tube [Ft], lung [Lg], and ear, nose, and throat [ENT]) and age of diagnosis are shown. The affected Oc cases in generation III are BRCA1 and BRCA2 mutation-negative. WES was performed on PBL DNA from sisters (Ov 52 and Ft/Ov 57) from F1528 (middle). Protein location of p.L605F on FANCI (previously KIAA1794; bottom). B) Functional analyses of FANCI isoforms using HeLa cells. C-E) Investigation of carrier frequency of c.1813C>T in FC OC and BC cases (c) and cancer-free controls from CARTaGENE (d), and FANCI variants in non-FC OC/BC cases and controls.

Solenoid domain=antiparallel pairs of α-helices that form α-α superhelix segments; Helical domain=α-helices; Ubiquitination site, K523=site of monoubiquitination by the FA core complex to allow downstream FA pathway function48,49; S/TQ cluster=location of conserved phosphorylation sites51

In vitro analysis revealed FANCI p.L605F isoform behaves differently than wild-type protein

Using established in vitro assays, we observed that FANCI p.L605F was expressed as a full-length protein with severely affected capacity to localize to sites of DNA damage as compared with wild-type control. To further investigate the functional impact of FANCI p.L605F isoform, both HeLa CRISPR FANCI knock-out (Figure 2a-g, Supplementary Figure 1) or HeLa FANCI siRNA knockdown cells (Supplementary Figure 1) were complemented with the FANCI p.L605F isoform. Western blot analysis of cells treated with the DNA damaging agent mitomycin C (MMC) showed decreased levels of FANCI p.L605F isoform, unlike the FANCI p.P55L isoform encoded by polymorphic variant c.164C>T which has been reported to exhibit wild-type function35 (Figure 2a, Supplementary Figure 1). Increasing the quantity of transfected FANCI c.1813C>T DNA by three-fold did not overtly affect the level of protein expression comparable to that seen in the wild-type FANCI or p.P55L isoform (Supplementary Figure 1). Essential to downstream FA pathway function is the interdependent monoubiquitination of both FANCI and FANCD234-36. Though FANCI p.L605F isoform co-immunoprecipitates with FANCD2, ubiquitination levels of FANCD2 were severely diminished as compared to those in FANCI wild-type expressing cells (Figure 2a-b). These results are consistent with the decrease in the intensity of FANCD2 (see upper band in Figure 2a) after MMC treatment in cells complemented with FANCI p.L605F as compared to the WT or p.P55L isoforms. These observations suggest that while physical interactions between FANCI p.L605F isoform and FANCD2 proteins are maintained the altered FANCI isoform may affect monoubiquitination of FANCD2. Monoubiquitination of FANCD2 is required to form MMC-induced foci and consistent with this role the expression of FANCI p.L605F led to a significant reduction in the number of FANCD2 foci (Figure 2c, Supplementary Figure 1).

Figure 2.
Figure 2.

p.L605F variant impairs FANCI stability and functions. A) HeLa FANCI-/- cells, clone 1, were complemented with indicated constructs of Flag-FANCI variants or empty vector (EV) and treated with 50 ng/ml MMC for 18 hours. Ubiquitination of FANCI and FANCD2 (upper band, H) after treatment was assessed by western blot. L=lower band, corresponds to non-ubiquitinated FANCI or FANCD2. B) HeLa FANCI+/+ cells were transfected with siRNA targeting FANCI and then complemented with Flag-FANCI siRNA resistant constructs or EV. Cells were treated with 50 ng/ml MMC for 18 hours followed by FLAG immunoprecipitation. Immunoprecipitated FANCD2 was analyzed by western blot. The ratio between the upper band (H) and lower band (L) was calculated. C) HeLa FANCI-/- cells, clone 1, were complemented with indicated constructs of Flag-FANCI variants or EV and 0.1 µg of empty GFP vector. After treatment with MMC (50 ng/ml, 18 hours), FANCD2 foci were counted in GFP positive cells. Mean with SEM are shown, and Kruskall-Wallis test was performed. P-values are shown. D-F) HeLa FANCI-/- cells, clone 1, were complemented with indicated constructs and treated with CHX and either mock-treated (d) or treated with damaging agents (e, f) for indicated times. At each time point, whole cell extracts were analyzed by western blot to assess protein levels. G. HeLa FANCI-/- cells, clone 1, were transfected with EV or indicated Flag-FANCI constructs. Cell viability was monitored following cisplatin or Olaparib treatments for 72 hours. Cell viability was assessed by counting remaining nuclei. Expression of Flag-FANCI constructs in HeLa FANCI-/- complemented cells was monitored by western blotting.

As the expression of FANCI p.L605F appeared to be lower than the WT or p.P55L isoforms, even when increasing the quantity of plasmid (Figure 2a, Supplementary Figure 1), we suspected that this protein isoform was unstable. To investigate protein stability, cells expressing FANCI wild type protein, or either of the p.L605F and p.P55L isoforms, were treated with cycloheximide (CHX) to inhibit protein synthesis and then treated with MMC or formaldehyde to induce DNA damage. FANCI protein levels decreased over time in response to both DNA damaging agents (Figure 2d-f, Supplementary Figure 1). This effect was more prominent in FANCI p.L605F expressing cells as compared to wild-type FANCI or p.P55L expressing cells. These observations suggest that treatment with genotoxic agents exacerbates FANCI p.L605F protein instability. This is in agreement with the observation that FANCI p.L605F failed to complement survival of the HeLa FANCI-/- cells that were challenged with the platinum compound cisplatin (Figure 2g, Supplementary Figure 1). In contrast, FANCI-/- cells were not sensitive to olaparib, a PARPi (Figure 2g, Supplementary Figure 1).

FANCI c.1813C>T carriers are enriched in familial OC cases of FC descent

Based on the anticipated founder effects of the FC population30,46,47, we assessed FANCI c.1813C>T carrier frequency in available PBL DNA from index OC or BC cases of FC descent to determine if this variant plays a role in conferring risk in phenotypically defined cancer families18,19,48-55,20,21,23,24,30,32,33,39. These OC or BC cases were selected based on their family history of OC or BC, or regardless of cancer family history (referred to as sporadic cases in this study), where BRCA1 and BRCA2 pathogenic variant carrier status was known30,32,33,46-51,56-59. Index OC cases from OC families (3/43, 7%) and index BC cases from hereditary breast and OC (HBOC) families (3/82, 3.7%) had a higher carrier frequency than BC cases from hereditary BC (HBC) families (3/158, 1.9%), though this difference was not statistically significant (p=0.41) (Table 1, Figure 3, Supplementary Figure 2).

View this table:
Table 1.

Comparison of FANCI c.1813C>T carrier frequencies in cancer cases to cancer-free women of FC descent.

Figure 3.
Figure 3.

Pedigree of a BRCA1 and BRCA2 mutation-negative two-case FC OC family F1620 where FANCI c.1813C>T; p.L605F was identified by WES. Cancer type (ovarian [Ov] and leukemia [Leu]), risk reducing surgery (total abdominal hysterectomy/bilateral salpingo-oophorectomy [TAH/BSO]), and age of diagnosis are shown.

The FANCI variant carrier frequency was also higher in sporadic OC cases (7/439, 1.6%) than sporadic BC cases (8/558, 1.4%) though this difference was not statistically significant (p=1) (Table 1). When taken together, FANCI c.1813C>T variant carrier frequency was highest in index OC or BC cases from OC and HBOC families, respectively, and sporadic OC cases as compared with sporadic BC cases (Table 1). The highest frequency of FANCI variant carriers was in OC index cases from OC families (at 9.1% [all] or 12.5% [BRCA1 and BRCA2 mutation-negative]) when also including the multi-case discovery family in this group, which is significantly higher compared to sporadic OC cases (p=0.012 [all] or p=0.01 [BRCA1 and BRCA2 mutation-negative]).

Cancer-free FC FANCI c.1813C>T carriers are significantly correlated with having a first-degree relative with OC

Since our initial discovery of the FANCI c.1813C>T variant, new data has become available from the CARTaGENE biobank enabling the evaluation of its allele frequency in study subjects from a cancer-free female FC population, and thus providing a more comparable reference group to our FC cancer subjects60. Using data from three different genotyping platforms, we estimated a 1.2% VAF in cancer-free FC female (Supplementary Table 2). This is not significantly different from the 1% estimated VAF in non-Finnish EURs, a population most likely to share common ancestry with FCs (France)26,27, as reported in the Genome Aggregation Database (gnomAD)61 (Supplementary Table 2). In this database the VAF varied across populations: highest in Estonians (2.1%) to none in East Asians.

The estimated heterozygous carrier frequency at 2.5% in cancer-free FC females was lower than that observed in index cancer cases from OC (7%) and HBOC (3.7%) families, but higher than observed in sporadic OC cases (1.6%) and index BC cases from HBC families (1.9%), though these differences were not statistically significant (Table 1). Notable was a trend towards statistical significance for the presence of variant carriers in OC families with the inclusion of the multi-case OC discovery family in our analysis (p=0.026 [all] or p=0.023 [BRCA1 and BRCA2 mutation-negative]).

Additional information was available from the CARTaGENE subjects to investigate FANCI c.1813C>T carrier frequency in the context of cancer family history (first-degree only), reproductive history, oral contraceptive pill (OCP) use, oophorectomy, and tubal (fallopian) ligation; all of which are factors that are known to significantly impact lifetime risk of OC62,63. We observed that cancer-free variant carriers (male or female) were significantly correlated with having a first-degree relative with OC (ρ=0.037; p=0.011), when analyzing data from subjects genotyped with arrays that included probes for the variant allele (n=7272) (Supplementary Table 3). This finding is consistent with OC family history as a risk factor for OC4. When adding data from cancer-free female and male subjects where genotypes were imputed (n=927) variant allele carriers were correlated with having a first-degree relative with OC or BC (ρ=0.026; p=0.046) (Supplementary Table 3, Supplementary Table 4). No other cancer type was significantly correlated with variant carrier status. Notably, the majority of cancer-free FC females were parous (78%; 2315/2950) and 91.8% (2710/2950) had experienced OCP use, oophorectomy, and/or tubal ligation (Supplementary Table 5), as all of these factors are known to significantly decrease OC risk9,10,64-73. Only 8.1% (6/74) of variant carriers reported having never experienced any of these risk reducing events.

Other potentially pathogenic FANCI variants are rare in OC and BC cases of FC descent

To determine if there are other potentially pathogenic FANCI variants (VAF<1%) in FCs, we investigated available WES data from 81 familial and/or young age of onset OC cases and 76 BC cases from HBC/HBOC families, regardless of BRCA1 or BRCA2 pathogenic variant carrier status (Supplementary Table 1). In all, we identified seven rare variants among 33 index OC familial cases, where one carrier was heterozygous for FANCI c.1573A>G; p.M525V (Supplementary Table 6). Although the missense variant is predicted to result in a methionine to valine change affecting a highly conserved amino acid residue at position 525 (GERP++ score = 5.68) and to be potentially pathogenic by 7/14 in silico tools, our in vitro analyses suggested that it does not encode an aberrantly functioning protein (data not shown). Thus, FANCI c.1813C>T is the only plausible potentially pathogenic variant identified in FC OC/BC cases (Figure 4a).

Figure 4.
Figure 4.

The location of potentially pathogenic variants in FANCI from different study groups. Rare (VAF<1%), potentially pathogenic FANCI variants in FC (a), AUS (b), CDN (c) OC and/or BC cases, and AUS controls (d). Refer to supplementary table 1 for cohort descriptions.

OC and BC cases of non-FC descent also carry potentially pathogenic FANCI variants

To determine if there are carriers of rare potentially pathogenic FANCI variants in non-FC populations, we investigated available WES data from 516 AUS HGSC cases74 and 63 CDN BC families, all BRCA1 and BRCA2 mutation-negative (Supplementary Table 1). We also investigated available sequencing data for FANCI from 4,878 AUS cancer-free controls. Principal component analysis of the AUS cases and controls using data from ethnicity associated single nucleotide polymorphisms (SNP) suggested that >95% of these cases are of Western EUR ancestry, whereas mixed EUR ancestry was reported for CDN cases.

In all, we identified a total of 18 and 92 rare (VAF<1%) FANCI variants in the AUS HGSC cases and controls, respectively. There were 17 carriers of eight potentially pathogenic missense variants in 516 HGSC cases (3.3%), where 10 (1.9%) carried FANCI c.1813C>T (Table 2, Figure 4b, d, Supplementary Table 6). In AUS controls, we identified 133 carriers of 32 different potentially pathogenic missense variants (2.7%), where 95 (1.9%) carried FANCI c.1813C>T. The number of carriers of potentially pathogenic variants in FANCI was not significantly different between AUS cases and controls (p=0.48), including FANCI c.1813C>T (p=1).

View this table:
Table 2.

Carrier frequencies of potentially pathogenic variants in FANCI from AUS HGSC cases and controls. 1

FANCI carriers were diagnosed with OC between the ages of 31-82 years (Supplementary Table 7). Five of the c.1813C>T carriers had a family history of OC within third degree relatives (5/98, 5.1%), which was significantly higher than the carrier frequency of this variant in isolated cases of HGSC cases (5/418, 1.2%; p=0.025) (Table 2). In contrast, there was no significant difference in the carrier frequency of FANCI c.1813C>T in cases with a reported family history of OC or BC (6/262, 2.3%) than those without (4/254, 1.6%; p=0.75). FANCI c.1813C>T co-occurred with another potentially pathogenic missense variant, FANCI c.2366C>T; p.A789V, in a HGSC case with a family history of OC. Two carriers of other potentially pathogenic variants in FANCI (c.1264G>A; p.G422R and c.1412C>G; p.P471R) also had a family history of OC (Table 2). The number of carriers of potentially pathogenic FANCI variants with a family history of OC (7/98, 7.1%) was significantly different than isolated cases of HGSC (p=0.027), but there was no significant difference when accounting for family history of OC or BC (p=1). In contrast, FANCI c.1813C>T was the only variant identified in 1/63 (1.6%) familial CDN BC cases (Figure 4c, Supplementary Table 6) and the carrier is known to be of Greek Canadian origin.

The association of potentially pathogenic variants in HGSC cases was compared with controls in AUS study subjects (Table 3). There was no significant difference in allele frequencies of FANCI variants in cases versus controls, though odds ratios (ORs) were >1 for three of these variants. As not all FANCI variants were identified in AUS controls, we used data from the non-cancer samples in the gnomAD database61 to evaluate the ORs. The allele frequency of all gnomAD samples was used as the AUS population is likely of mixed ancestry as exemplified by the observation that c.13A>G; p.I5V was only identified in the East Asian population in gnomAD (Supplementary Table 6). The OR was >12 for six of seven of the rarest FANCI variants (VAF<0.1%), in contrast to 1.46 for the most common FANCI c.1813C>T (Supplementary Table 8). FANCI c.286G>A had an OR <1 when compared to all gnomAD samples61. However, when this analysis was performed with data from the non-Finnish EUR population, the rationale being that over 90% of AUS cases are likely of white EUR ancestry, the OR was >3 (Supplementary Table 8). Our findings suggest that rare potentially pathogenic FANCI variants, including FANCI c.1813C>T, may play a role in hereditary OC cases from AUS cases.

View this table:
Table 3.

Comparison of potentially pathogenic FANCI variant carrier frequencies in AUS HGSC cases to controls.

To further evaluate the effect of FANCI variants in conferring risk to OC and BC in non-FC populations, we investigated rare variants (VAF<1%) from imputed SNP array data that was available from two case-control studies: Ovarian Cancer Association Consortium (OCAC)75 and Breast Cancer Association Consortium (BCAC)76,77. In all, nine missense and one splice site variant were identified in OCAC and BCAC databases. With the exception of FANCI c.1813C>T none of the other missense variants were predicted to be potentially pathogenic (Supplementary Table 9). The data imputed from the OCAC database75 revealed that the OR for FANCI c.1813C>T was highest in endometrioid and HGSC subtypes compared to all histopathological subtypes combined, though there was no significant difference in allele frequency in OC cases compared to controls (Supplementary Table 10). To compare to a known OC pathogenic variant, OCAC data was investigated for the most common pathogenic BRCA1 variant reported in FCs, c.4327C>T; p.R1443X, which is one of the most commonly reported variants from populations of EUR descent46. The OR was highest in HGSC cases, though there was no significant difference in allele frequency when all OC subtype cases were compared to controls (Supplementary Table 10). There was no significant difference in allele frequency between BC cases and controls for FANCI c.1813C>T in a similar analysis of BCAC case-control data76,77 (BRCA1 c.4327C>T data was not available in the BCAC database) (Supplementary Table 10). These findings show that FANCI c.1813C>T carriers occurred in non-FC populations and suggest a trend towards c.1813C>T carriers in HGSC and endometrioid OC as compared to other OC subtypes.

Clinical features of FC OC from FANCI c.1813C>T carriers are similar to those of HGSC cases

We reviewed available clinical characteristics of OC in FANCI c.1813C>T carriers as CPGs have been associated with specific subtypes of OC. For example, pathogenic BRCA1 variants are often associated with HGSC and high-grade endometrioid subtypes of OC and younger age at diagnosis39,78-81. Given the paucity of FANCI variants, we focused on 13 FC OC carriers of FANCI c.1813C>T variant (Table 1) and noted that 12 had serous and one had a mucinous subtype OC (Supplementary Table 7). The seven carriers found in the context of sporadic OC cases (Table 1) were reported as HGSC subtype. The remaining six carriers were identified in OC case with a known family history of cancer (Table 1), where five had serous subtype OC and one had a mucinous subtype OC. Though the sample size was limited, there appeared to be no striking differences in the ages of the diagnosis for OC in carriers where age ranged from 40 to 81 years (average = 59.2 years) as compared with non-carriers in the sporadic OC group (average = 61 years), and aligned with average age of diagnosis of OC in the North American population1 (Supplementary Table 7).

Survival data, available for sporadic OC cases, showed that all seven FANCI c.1813C>T carriers were deceased having had an average survival of 61.1 months (range 9-163). Due to sample size we were unable to perform survival analysis using Kaplan-Meier estimation: 57% (4/5) OC cases did not survive past five years though it should be noted that one of these cases survived 61 months (Supplementary Table 7). Survival past 61 months in FANCI c.1813C>T carriers (2/7; 28%) is comparable to non-carrier sporadic HGSC cases (100/334; 30%).

Co-occurrence of other potentially pathogenic variants in OC predisposing genes in FANCI c.1813C>T carriers

To further characterize the germline genomic landscape of FANCI c.1813C>T carriers, we performed WES analysis of all seven carriers identified in the sporadic FC OC cases and compared it with WES data from five carriers identified in OC families (Table 1). We analyzed FANCI c.1813C>T OC (n=12) carriers for the co-occurrence of pathogenic variants in known high-risk OC predisposing genes82, as these variants are known to significantly increase cancer risk. Only previously known carriers of BRCA1 (F1055 and F1520) or BRCA2 (F762) pathogenic variants in familial cases were identified (Table 1, Supplementary Figure 2). None of the sporadic OC cases (n=7) carried pathogenic variants in BRCA1, BRCA2, BRIP1, RAD51C, and RAD51D. Moreover, the FANCI c.1813C>T variant did not co-occur in carriers of the recently reported potentially pathogenic RAD51D c.620C>T; p.S207L33 variant found to recur in sporadic FC HGSC cases33.

FANCI protein is expressed at low-to-moderate levels in HGSC tumour samples

As FANCI protein expression has not been investigated in OC nor fallopian tube epithelial (FTE) cells, a proposed tissue of origin for the HGSC subtype83-89, we performed immunohistochemistry (IHC) analysis of an available tissue microarray (TMA) containing cores from formalin-fixed paraffin-embedded (FFPE) tumor tissues. IHC analysis of fallopian tube revealed strong nuclear and low-to-moderate cytoplasmic staining in FTE cells in contrast to stromal cell components where staining was low or undetectable (Figure 5a, Supplementary Figure 3). These observations suggest that FANCI protein is robustly expressed in cells associated with the origins of HGSC. In contrast, IHC analysis of tumour cells in HGSC tissue cores exhibited variable staining (Figure 5b, Supplementary Figure 3), where the majority (83/94, 88.3%) exhibited low-to-moderate staining intensity. All HGSC tissue cores exhibited strong nuclear and moderate cytoplasmic staining in epithelial cell components, in contrast to the stromal cell components where staining intensity was low or undetectable. A separate IHC analysis of tumour tissues available from eight FANCI c.1813C>T carriers revealed a range of staining intensity (Supplementary Figure 3), consistent with the expectation that the variant allele could be expressed in tumours (Figure 2a). Using Kaplan-Meier survival analysis we found no correlation of staining intensity in epithelial tumour cell components of the HGSC tissue cores with overall or progression free survival (Figure 5c). Moreover, age at diagnosis, disease stage, residual disease, chemotherapy type, and survival (disease-free and 5-year) were not correlated with the intensity of protein staining. We were not able to similarly investigate FANCI variant c.1813C>T; p.L605F carriers due to the small number of cases. In cases (n=90) that received standard of care chemotherapy (adjuvant taxol and carboplatin) there appeared to be a trend towards lower FANCI staining intensity in HGSC tumour cores from cases having had a prolonged disease-free survival (p = 0.124) (Figure 5c).

Figure 5.
Figure 5.

FANCI protein expression in HGSC by IHC of TMA analyses. A) An example of IHC analysis of FANCI protein of a paraffin embedded normal fallopian tube tissue core. B) Examples of different patterns of intensity of IHC analysis of FANCI protein of HGSC tissue cores (epithelial cell components scored). C) Kaplan-Meier survival curve of HGSC cases for disease-free survival (in months) in epithelial cell component. Cases included in the analyses had received only adjuvant taxol and carboplatin chemotherapy. Survival curve was calculated according to Kaplan-Meier method coupled with a log rank test. E=epithelial component; S=stromal component

Discussion

Our investigation of FANCI c.1813 C>T identified by WES analysis of a BRCA1 and BRCA2 mutation-negative multi-case OC family of FC descent suggests that this variant may play a role in OC risk. Our investigation was predicated upon the strong founder effects observed in FCs of Quebec and the expectation that candidate risk alleles would recur and thus could be readily identified due to common ancestors in this population26,27. Our strategy focused on screening this variant in BRCA1 and BRCA2 mutation-negative multi-case OC families of FC descent with the expectation that familial aggregation of OC is not by chance but due to an underlying genetic factor. Given founder effects, we also expected that our candidate alleles would recur in sporadic FC OC cases. Indeed, we showed that FANCI c.1813 C>T not only recurs in FCs but is found at a higher frequency in OC cases with a family history of OC relative to sporadic OC cases and cancer-free controls from the same population. Taken together these findings support a role for FANCI c.1813C> in modifying OC risk in the FC population.

FANCI c.1813C>T was the only potentially pathogenic FANCI variant identified in our study of FC cancer cases. Our findings are reminiscent of the recurrence of specific variants in familial FC cancer populations of Quebec, such as RAD51D c.620C>T; p.S207L in familial and sporadic OC cases33, PALB2 c.2323C>T; p.Q775X in BC cases and HBC families32,90, and MSH6 c.10C>T; p.Q4X in colorectal cancer (Lynch Syndrome) families91. Given the genetic demography of the FC population of Quebec, it is likely that carriers of FANCI c.1813C>T have common ancestors as has been shown with carriers of specific recurrent pathogenic variants in BRCA148,92, BRCA247,48,93, and MSH691 reported in cancer families. As has been reported with all of these examples of CPGs in non-FC populations, we expected an array of potentially pathogenic variants in our candidate gene. Indeed, we observed eight potentially pathogenic FANCI variants in AUS HGSC cases, which included c.1813C>T. A recent genome-wide discovery study of AUS HGSC cases did not report FANCI among the list of potentially new CPGs for OC74. However, the missense FANCI variants found in our analysis of AUS samples, which were investigated in both studies, would have been excluded due to a focus on LoF variants74. Our investigation of HGSC cases from the AUS population thus also suggest that FANCI variants may also play a role in OC in non-FC populations.

Although a mechanism of action for FANCI in OC risk is unknown, our findings suggest that the FANCI c.1813C>T variant affects gene function. This is suggested by the instability of the variant encoded isoform based on our in vitro analyses. Though tumour DNA was not available for all of our variant carriers, Sanger sequencing of DNA from FFPE tumour cells suggest loss of the wild type allele and retention of the variant allele had occurred in two FC HGSC FANCI c.1813C>T carriers, as shown in Supplementary Figure 4. Interestingly, tumour samples from a bilateral OC case predominantly exhibited the FANCI variant allele suggesting that loss of the wild type allele could have been be an early event in tumour progression in this case. Also, HGSC samples from both cases had acquired somatic pathogenic variants in TP53, a known major driver of the majority of HGSC94,95. Our IHC analyses showed differential FANCI protein expression, with a high proportion of HGSC tumour cells exhibiting low-to-moderate levels of protein expression. This is in contrast to robust FANCI protein expression observed in FTE cells, a purported origin of HGSC83-89. All of these findings suggest loss of FANCI may play a role in OC akin to that suggested by other CPGs in the HR pathway, such as BRCA1 and BRCA296. In keeping with this hypothesis is that loss of the chromosome 15q arm, which contains the FANCI locus (15q26.1), has been reported in 55% of 978 HGSC samples by The Cancer Genome Atlas (TCGA) project95. A review of available genomic data from TCGA project (cbioportal.org) revealed that five tumour samples likely had homozygous deletions involving the FANCI locus and all such samples exhibited low FANCI mRNA expression. As expected by observations from previous studies of the genomic landscape of HGSC tumour DNA, somatic potentially pathogenic variants in FANCI are also rare (<1%)95.

Based on available genetic data from non-Finnish EURs, a population comparable to the ancestral origins of FCs, the allele frequency of FANCI c.1813C>T at 1% is higher than expected as compared to many pathogenic variants in established CPGs such as BRCA1 and BRCA2, or the recently proposed OC risk genes, such as RAD51D33,46. Similarly, the carrier frequency of c.1813C>T in AUS cancer-free controls at 1.9% was more common than anticipated. The carrier frequency of c.1813C>T in the general population is reminiscent of the more common potentially pathogenic CHEK2 c.1100delC variant, a moderate risk BC predisposing variant, which was originally identified at a frequency of 1.4% in population controls97. Moreover, this CHEK2 variant was also found more frequently in BC cases from HBC families than sporadic BC cases, relative to healthy controls97. Similarly, LoF germline variants in BRIP1 were more frequently identified in OC cases with a family history of OC than with a family history of BC only, relative to control cohorts98. Although our findings of estimating the overall risk to OC using OCAC data was inconclusive, we estimated that carriers of FANCI c.1813C>T variant in FC BRCA1 and BRCA2 mutation-negative OC families have increased risk based on the OR of 5.6 (p=0.006; 95% CI=1.6-19). Though the confidence interval is wide, due to the small sample size, our findings are supported by the observation that cancer-free FANCI c.1813C>T carriers (male or female) were significantly correlated with having a first-degree relative with OC in the FC population, using CARTaGENE data.

It is interesting that rs8037137, which is located 1.68 mega-base pairs downstream of FANCI c.1813C>T, was among the polymorphic genetic markers found significantly associated with risk to either invasive epithelial or HGSC subtype OC in a large genome wide association analysis of OCAC data75. Consistent with these findings is our observation that the OR for FANCI c.1813C>T in the OCAC study groups are highest in endometrioid and HGSC subtype OC cases. A similar analysis of other potentially pathogenic FANCI variants identified in our study was not possible as corresponding genetic data was not available in the OCAC database. These observations, along with higher frequency of FANCI c.1813C>T in familial and sporadic OC cases relative to cancer-free controls, suggest the possibility that FANCI c.1813C>T may modify risk to OC at levels lower than high risk pathogenic variants found in BRCA1 and BRCA2. Though the allele frequency of our rare FANCI variant was higher in familial OC cases relative to sporadic forms of the disease in FC OC cases, we are mindful of the limitations of our study due to sample size. Therefore to further investigate this hypothesis about levels of risk to OC, we estimated a sample size of approximately 100 OC families and 7,000 female cancer-free controls or 13,000 HGSC cases and 115,000 female cancer-free controls to achieve 80% power would be required (https://www.openepi.com/SampleSize/SSCC.htm), numbers that are currently unattainable in FCs.

The role of FANCI c.1813C>T in modifying risk to BC is unclear. Although variant carriers were found in FC familial BC cases, there were proportionally more carriers in BC cases from HBOC families than in HBC families. We also identified a variant carrier in a BC family of Greek Canadian origin: this family was also ascertained from the same catchment area as many of our FC cancer families. In our analysis of FC cancer-free controls that included imputed genotypes, variant carriers were significantly correlated with having a first-degree relative with OC or BC. These findings are in part reminiscent of the variable penetrance for BC and OC for known high risk CPGs, where carriers are more likely to harbour pathogenic variants in BRCA1 or BRCA2 (or PALB2) based on family history of BC and OC48. Thus, it is possible that FANCI c.1813C>T confers risk to BC that is lower or more variable than for OC. However, there have been independent reports of BC cases carrying other FANCI variants with VAF 10-3 to 10-6 in cancer-free individuals. At least 19 different variants have been described in familial and/or sporadic BC cases: four nonsense, three frameshift, two splicing, and 10 missense variants (see Supplementary Figure 5 and Supplementary Table 11)99-106. These FANCI variants were reported in Finnish104 (4/1524, 0.3%), Chinese103 (1/99, 1%), and two Spanish101,105 (1/154, 0.6% and 1/94, 1.1%) studies. It is possible that these rare FANCI variants, which include putative LoF variants, affect BC risk in various populations.

There have been reports of FANCI variant carriers in a variety of cancer types such as prostate cancer104,107,108, sarcoma109, malignant pleural mesothelioma110, acute myeloid leukemia111, head and neck carcinoma112, and colorectal cancer113 (see Supplementary Figure 5 and Supplementary Table 12). Although we also observed colorectal cancers in our FANCI variant carrier families of FC descent, a pedigree review found no significant differences in the number of colorectal cancer cases in pedigrees from variant carriers as compared to non-carriers (p=0.47). This observation is consistent with our analysis of family history of cancer-free carriers in the FC population using the CARTaGENE biobank. The role of FANCI variants in other cancer types remains to be determined.

Research has shown that FANCI plays a role in the response to DNA damage. FANCI regulates the recruitment of the FA core complex to sites of interstrand crosslinks, and thus plays an important function upstream in the FA-HR DNA repair pathway114. FANCI encodes one of only two proteins that comprise the ID2 complex, the other being FANCD2, which is distinct from the FA core complex that includes proteins such as FANCC and FANCM (reviewed by Niraj et al.115). In vitro cell lines modeling pathogenic variants or gene knock outs of BRCA1, PALB2, or RAD51D have exhibited sensitivity to cisplatin and PARPi’s, providing some insight into their role in DNA repair33,116-118. Our observations in cell lines expressing the FANCI p.L605F isoform differs in that we observed sensitivity to cisplatin but not to the PARPi, olaparib. These findings are consistent with an independent report showing lack of sensitivity to a PARPi (KU0058948) in a fibroblast cell line transduced with HPV E6/E7 from a FANCI FA patient, as well as in cell lines generated from FANCA, FANCL, FANCD2 and FANCJ (BRIP1) patients119. The indirect role of FANCI in HR DNA repair and recent evidence suggesting that FANCI also has functions independent from the FA DNA repair pathway120-124 may be consistent with our in vitro studies. Two FANCI c.1813C>T variant carriers survived over five years after initial diagnosis (nine and 13.5 years). The lengthy survival time is unusual given the overall five- and ten-year survival rates of 32% and 15%, respectively, reported for advanced stage HGSC cases in North America6. Further studies of FANCI are warranted as these findings are consistent with our observation of a trend towards low FANCI protein expression with better disease-free survival in HGSC cases, though these findings are not significant.

Although the biological role of FANCI remains to be elucidated, biallelic inactivation of FANCI has been associated with FA, a rare disease that is characterized by congenital defects and developmental disabilities34-36. FA is a heterogenous disease with 22 known causal genes, where FANCI cases comprise approximately 1% of all FA diagnoses125. As FANCI associated FA cases are rare, the incidence of cancer in biallelic carriers has not been reported. Interestingly, though a Fanci knockout mouse model was recently reported showing a low Mendelian ratio there was no information on cancer incidence126.

This is the first study to describe potentially pathogenic variants in FANCI in the context of familial OC and in a member of the ID2 complex of the FA DNA repair pathway. Our strategy of investigating familial and sporadic cancer cases from a population showing strong founder effects and pursuing in vitro molecular analysis of missense variant found to recur in cancer cases contributed to the discovery of FANCI as a new candidate OC risk gene. While the feasibility of experimenting with missense variants at the molecular level can be an issue, this study reveals the importance of pursuing such variants during the gene discovery phase, especially when plausible candidates based on gene function are revealed by WES analyses of defined cancer families. Although some of the identified FANCI variants are predicted to affect gene function as shown in our in vitro analyses of FANCI c.1813C>T encoded isoform, further studies are warranted to evaluate their role in OC risk. Establishing risk is important in the context of familial aggregations of OC and host behaviours that modify risk to OC, as has been shown with OCP use in carriers of pathogenic BRCA1 and BRCA2 variants70. An investigation of carriers of potentially pathogenic FANCI variants is also warranted given the intriguing observation of sensitivity to cisplatin but not to olaparib in our in vitro studies of FANCI c.1813C>T, as this might impact the efficacy of PARPi’s in the treatment of HGSC in these cases.

Methods

Study subjects, samples, and DNA sequencing

Information about the study subjects, PBL and tumour DNA samples, and FFPE tissues of HGSC cases and normal fallopian tube used for TMAs were obtained from various biobanking resources (Supplementary Table 1). The OC samples from Réseau de recherche sur le cancer (RRCancer) Tumour and Data biobank derived its collection from patients attending a major gynecologic oncology hospital centre in Montreal. This centre largely services FCs, where it is estimated that 85% of samples come from participants who self-identify as FC46. Samples within this collection with a familial history of OC and/or BC have been extensively studied, where the majority self-report grandparental FC ancestry of index cancer affected cases30,48,49. This project has received approval from The McGill University Health Centre (MUHC) REB (MP-37-2019-4783 and 2017-2722). To further protect the anonymity of study subjects, all samples were assigned a unique identifier.

Discovery of FANCI c. 1813C>T in an OC family

The FANCI c.1813 C>T variant was initially discovered by WES and bioinformatic analyses of PBL DNA from sisters, both with OC, from family F1528 that were performed at the McGill Genome Centre (MGC). This multi-case OC family of FC descent, available from the RRCancer biobank, has been described previously as a BRCA1 and BRCA2 mutation-negative family39 and has since been updated to include new information, including histopathology of OC and a reported case of ear, nose, and throat cancer (Figure 1). PBL DNA (~500 ng) from two sisters from this family was captured with the Agilent SureSelect 50 Mb exome capture oligonucleotide library, and then sequenced with paired-end 100 bp reads on Illumina HiSeq 2000. After removing putative PCR-generated duplicate reads using Picard (V.1.48), sequencing reads were aligned to human genome assembly hg19 using a Burroughs–Wheeler algorithm (BWA V.0.5.9). Sequence variants were called using Samtools (V.0.1.17) mpileup and varFilter meeting the following criteria: at least three variant reads, ≥20% variant reads for each called position, and Phred-like quality scores of ≥20 for SNPs and ≥50 for small insertions or deletions. Annovar127 and custom scripts were used to annotate variants according to the type of variant, Single Nucleotide Polymorphism database designation (dbSNP), Sorting Intolerant from Tolerant (SIFT) score128, and allele frequency data from the 1000 Genomes Project45 and NHLBI ESP v.2014 (https://evs.gs.washington.edu/EVS/). Then, the variant list was organized to select top candidate potentially pathogenic variants that were shared in common among the two sisters by de-prioritizing the following: (1) synonymous or intronic variants other than those affecting the consensus splice sites; (2) variants seen in more than 5 of 416 exomes from patients with rare, monogenic diseases unrelated to cancer that were independently sequenced and available at the MGC and (3) variants with a frequency ≥1% in either the 1000 Genomes Project or NHLBI exome datasets. Using a candidate gene approach, we then further prioritized the list of candidates based on their role in FA-HR pathways. Using this strategy, FANCI c.1813C>T was the only candidate remaining on the list of prioritized variants (n=276) shared in common between the two sisters in family F1528. The presence of the FANCI variant was verified using Integrative Genomics Viewer (IGV)129. The FANCI c.1813C>T variant was validated by targeted PCR analysis and Sanger sequencing at the MGC using standard methods (see Supplementary Table 13).

Since the initial discovery of the FANCI variant in family F1528, newer WES technology and bioinformatic tools became available, and thus we repeated our analysis with DNA from the same sisters from this family. WES and bioinformatic analyses were again performed at the MGC using Roche NimbleGen SeqCap® EZ Exome Kit v3.0 (Roche Sequencing) followed by HiSeq 100 bp paired-end sequencing (Illumina) applying manufacturer’s protocols. Sequencing reads were aligned to human genome assembly hg19 using BWA-MEM v0.7.17, then deduplicated using Picard v2.9.0 (Broad Institute). Bases were recalibrated using the GATK best practices. Variants were called using HaplotypeCaller available from GATK v3.5 (Broad Institute) and recalibrated according to GATK best practices. The filtered variants were then annotated and loaded into a GEMINI v0.19.1 database as per the recommended workflow. Data was filtered for non-synonymous rare variants (VAF<1%) deduced from a publicly available database gnomAD v2.1.161 identified in genes with reported function in DNA repair pathways (n=276130). FANCI c.1813C>T was once again the only variant directly involved in the FA-HR DNA repair pathway identified in both sisters. The presence of the FANCI variant was again confirmed by IGV129 and validated by PCR analysis and Sanger sequencing at the MGC using standard methods (see Supplementary Table 13).

Genetic analysis of FANCI c. 1813C>T in FC cancer cases

The allele frequency of FANCI c.1813C>T was determined by investigating selected index OC or BC cases defined based on family history of OC and/or BC or sporadic disease where cases were not selected based on family history of cancer, where all were-self-reported FC descent as previously described30,48,49 (see Supplementary Table 1). The average age of diagnosis for OC families was 49.8 years (range 24-77). The average age of diagnosis was 44.6 years (range 22-65) and 43.7 years (range 18-65) for HBC and HBOC families, respectively. Sporadic BC cases were diagnosed with invasive BC before the age of 70 (average = 52.7, range 25-69)131. We cannot exclude the possibility that some cases occurred in more than one study group: based on RRCancer biobanking sample number, OC cases from at least 13 families were also found in pedigrees from BC cases that were genotyped from the familial HBOC study group.

Carriers of FANCI c.1813C>T were identified by targeted genotyping of PBL DNA samples or from surveying available WES data (subjected to the same latest WES technology and data analysis pipeline as described above) from affected cases in our study groups (see Supplementary Table 1). PBL DNA from OC or BC cases were genotyped using a custom TaqMan® genotyping assays based on established methods (see Supplementary Table 14). Where normal DNA was no longer available from the study case, genomic DNA extracted from the tumor (if available) was provided by the RRCancer biobank for genotyping. PBL DNA from sporadic BC cases were genotyped using Sequenom® iPLEX® Gold Technology at the MGC131. Samples that were removed from the analysis were due to poor DNA quality (n=30), duplication (n=1), or were from cases exceeding age limit criteria (70 years or older when diagnosed with first invasive BC; n=2). Results from a total of 558 cases were evaluated for FANCI c.1813C>T carrier status. The FANCI locus (NC_000015.9: g.89828441C>T) was reviewed in WES data, validated by IGV analysis, and FANCI c.1813C>T variant carriers verified by Sanger sequencing as described (see Supplementary Table 13).

Genetic analysis of FANCI c. 1813C>T in FC cancer-free controls

Genotyping data was obtained from CARTaGENE (www.cartagene.qc.ca) from cancer-free FC subjects as controls. The overall average age in this study group was 54.45 years (range 39.06-71.05)60. The study subjects were comprised of 2,627 females (average age = 54.45 years; range 39.06-71.05) and 2018 males (average age = 55.3 years; range 39.1-70.9). Selection criteria for individuals with genotyping data are biased towards individuals with higher quantity of health data (see Supplementary Table 4). Individuals were defined as FC if they were born in Quebec, their parents and all four grandparents were born in Canada, and French was the first language learned. Genotyping data was available from samples that were genotyped in three different batches of experiments that used two different genotyping platforms (Illumina and Affymetrix; see Supplementary Table 4). Data was imputed when there was no representative probe for a locus on the genotyping array using the Sanger Imputation Service (https://imputation.sanger.ac.uk/) with Haplotype Reference Consortium (release 1.1) as the reference panels. Pre-phasing and imputation was performed using Eagle2134 and the positional Burrows-Wheeler transform (PBWT)135. Samples were removed as part of quality control to improve imputation of the array (see Supplementary Table 4).

Statistical analyses of FANCI c. 1813C>T frequency in FC cancer cases and controls

Two-sided Fisher exact test was used to compare frequencies of FANCI c.1813C>T carriers in the cases and controls or between different study subjects, where a p-value of 0.05 was considered significant. ORs and 95% confidence intervals were estimated for all study subjects for this allele.

Genetic analysis of FANCI locus in FC cancer cases

The FANCI locus was investigated in available WES data from 157 OC or BC cases of FC descent (see Supplementary Table 1). Rare (VAF<1%) FANCI variants identified in WES data were further subjected to bioinformatic analyses using up to 16 in silico predictive of the effect of the nucleotide change(s), which includes two tools to predict splice site variants. Variants were considered potentially pathogenic if they were predicted to be pathogenic/deleterious in ≥8 tools for missense variants or two tools for splice site variants. Nonsense variants were considered potentially pathogenic but in-frame deletions were not. Variants were annotated using the Ensembl Variant Effect Predictor136.

Genetic analysis of FANCI c. 1813C>T in OC and BC cases and controls from consortia databases

The FANCI locus was investigated in available OCAC and BCAC data. Summary statistics including log2OR, standard error (SE), X2, and p-value for 25,509 epithelial OC cases (22,406 invasive) and 40,491 controls of EUR ancestry75 were obtained from OCAC (http://ocac.ccge.medschl.cam.ac.uk). Summary statistics were available for histopathological subtypes as well as for the entire cohort in OCAC and have been previously summarized75. Summary statistics including log2OR, standard error (SE), X2, and p-value for 46,785 cases and 42,892 controls of EUR ancestry76,77 were obtained from BCAC (http://bcac.ccge.medschl.cam.ac.uk). Details of the subjects and genotyping analyses is described elsewhere75-77. Summary statistics for BRCA1 c.4327C>T and rs8037137 loci were obtained as comparators (see Supplementary Table 10). All rare (VAF<1%) FANCI variants identified in OCAC and BCAC were subjected to the same bioinformatic analyses using in silico tools as described.

Genetic analysis of FANCI locus in AUS HGSC cases and controls

The FANCI locus was investigated in germline sequencing data available from WES analysis of HGSC cases ascertained from the AUS population as previously described74. Briefly, all AUS cases had ovarian, fallopian tube, or peritoneal cancer (n=516) and did not carry pathogenic variants in BRCA1 and/or BRCA2 (see Supplementary Table 1). AUS controls were ascertained from the lifepool study as previously described137. Cancer-free women with available sequencing results for FANCI (n=4,878) were included in this study. The identified rare (VAF<1%) variants found in FANCI were subjected to the same bioinformatic analyses using in silico tools as described.

Genetic analysis of FANCI locus in CDN BC cases

The FANCI locus was investigated in germline sequencing data available from WES analysis of PBL DNA from female subjects with OC, BC, or pancreatic cancer (n=63) who were recruited from centres in Montreal via the McGill Cancer Genetics Programme. All recruited individuals had a strong family history of BC. A BRCAPro score138, which is based on studies of Ashkenazi Jewish and EUR descent individuals, was generated to predict the likelihood of families carrying pathogenic variants in BRCA1 or BRCA2. Individuals with a BRCAPro score of >10%, but with no pathogenic variants in these genes were selected. Of this set, 14 individuals were of Ashkenazi Jewish ancestry. FANCI variants were selected from PE125 WES data that was generated using the Nextera Rapid Capture Exome enrichment kit (Illumina) followed by HiSeq-4000 sequencing performed by the CRUK CI genomics core facility in the UK. Variant Call Format files were generated with a standard pipeline following GATK Best Practices recommendations for WES data. The identified rare (VAF<1%) variants found in FANCI were subjected to the same bioinformatic analyses using in silico tools as described.

Genetic analysis of variants in known OC predisposing genes and DNA repair genes in FANCI c. 1813C>T carriers

Rare (VAF<1%) variants that were identified in known high risk epithelial OC predisposing genes in the analysis of WES data from FANCI c.1813C>T carriers was investigated using various bioinformatic tools. Pathogenicity was evaluated in BRCA Exchange31 for BRCA1 and BRCA2 variants and ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/) for all variants. Rare (VAF<1%) variants in DNA repair pathway genes (n=276130) were evaluated in FANCI c.1813C>T carriers. The only variant identified that was shared in all cases was POLG c.2492A>G and it was pursued further as described below.

The allele frequency of POLG c.2492A>G was determined by investigating selected index OC or BC FC cases as above. Carriers of POLG c.2492A>G were identified by targeted genotyping of PBL DNA samples or from surveying available WES data from affected cases from our study groups as described. PBL DNA from OC or BC cases were genotyped using a custom TaqMan® genotyping assays based on established methods (see Supplementary Table 14). POLG c.2492A>G was reviewed in available WES data as above. Genotyping data from CARTaGENE for cancer-free FC controls was investigated as above, including imputation (see Supplementary Table 4). POLG c.2492A>G was subjected to the same bioinformatic analyses using in silico tools as described.

In vitro analysis of FANCI c.1813C>T variant and FANCI encoded protein

Cell lines, cell culture and reagents

HeLa cells were grown in Dulbecco’s modified Eagle’s medium (Corning™ cellgro™), supplemented with 10% Fetal Bovine Serum (Gibco™), at 37°C, 5% CO2, 20% O2. HeLa cells KO for FANCI were obtained using the ALT-R CRISPR-Cas9 system from Integrated DNA TechnologiesTM. Cells were transfected with crRNA:tracrRNA:Cas9 RNP-complexes (crRNA sequence: AATCCCCCGATTCCACCAAC), according the manufacturer’s guidelines for RiboNucleoProtein transfection using RNAimax. After transfection, genomic DNA from the pool of transfected cells was extracted using QIAamp DNA Mini Kit (Qiagen, ref 51306). A 500 bp DNA region containing the sgRNA complementing sequence was amplified by PCR from 400 ng of genomic DNA with the Thermo Scientific™ Phusion™ High-Fidelity DNA Polymerase and verified by sequencing using the following primers: Forward: 5’-GTTACTGGACTTCTCAAAAGCTGTAAG-3’ and Reverse: 5’-CTAGGTTGGGCACTTAAGTTTTCCT-3’. Sequencing results from non-transfected cells and genetically altered cells were compared using TIDE software to estimate the percentage of genetically altered cells. Clones were then generated and selected based on FANCI protein depletion using Western blot analysis. Two clones, clones 1 and 2, were used in this study.

When specified, cells were treated with MMC from Streptomyces caespitosus (Millipore-Sigma, ref M0440) or Formaldehyde (BAKER ANALYZED® ACS, J.T. Baker®, ref CAJT2106). For protein stability assays, CHX (Millipore-Sigma, ref C4859) was used at a final concentration of 100 μg/ml.

siRNA transfection and complementation assays

Approximately 2.5×105 HeLa cells were transfected with 50 nM of siCTL (UUCGAACGUGUCACGUCAA) or siFANCI (UGGCUAAUCACCAAGCUUAA) with RNAimax (Invitrogen) according the manufacturer’s protocol. Then, after 24 hours, cells were transfected again with the same siRNAs. After six hours, cells were complemented with the indicated constructs of Flag-FANCI or pcDNA3 plasmid (empty vector) using Lipofectamine 2000 according to the manufacturer’s protocol, using the following quantities of plasmids: 1 µg of WT, 3 µg of L605F and 1.5 µg of P55L.

Protein extraction and immunoblotting

Cells were collected by trypsinization and rinsed once in cold PBS. Cell pellets were then incubated in lysis buffer (10 mM HEPES pH 7.4, 10 mM KCl, 1% Triton, 150 mM NaCl, 30 mM Na2P2O7.10H2O, 1 mM EDTA and 1 µg/ml Leupeptin, 3.4 µg/ml Aprotinin, 1% PMSF, 5 mM NaF, 1 mM Na3VO4, Complete™ EDTA-free Protease Inhibitor Cocktail [Roche]) for 30 minutes on ice. Cell lysates were then sonicated for 5 minutes (30 seconds on, 30 seconds off, high, Bioruptor) and centrifuged for 30 minutes, 13000 rpm, 4°C. Supernatant was then processed for immunoblotting analysis using the indicated antibodies.

Antibodies for Western blotting and immunofluorescence assays

The antibodies used were anti-FANCI (A7) (Santa Cruz Biotechnology, ref sc-271316, 1:100), anti-FANCD2 (Novus, ref NB100-182D1, 1:5000 for western-blot, 1:1000 for immunofluorescence), and anti-vinculin (Sigma, ref V9131, 1:100000). Horseradish peroxidase-conjugated anti-rabbit IgG or anti-mouse (1:10000; Jackson ImmunoResearch) were used as secondary antibodies.

Cisplatin and olaparib cell survival assays

Approximately 3×105 HeLa Fanci-/- cells were seeded into one well of a six-well plate. After 24 hours, cells were complemented with the indicated Flag-FANCI construct using Lipofectamine 2000 (Invitrogen), and then after another 24 hours seeded in triplicate into a Corning 3603 black-sided clear bottom 96-well microplate at a density of 3500 cells per well. The remaining cells were stored at −80°C until processing for protein extraction and immunoblotting as described above. Once attached to the plate, the cells were exposed to different concentrations of either 0-300 nM cisplatin (Tocris, #2251) or 0-2.5 μM olaparib. After three days of treatment, nuclei were stained with Hoechst 33342 (Invitrogen) at 10 µg/ml in media for 45 minutes at 37°C. Images of entire wells were captured at 4× magnification using a CytationTM 5 Cell Imaging Multi-Mode Reader and Hoechst-stained nuclei were quantified with the Gen5 Data Analysis Software v3.03 (BioTek Instruments). Cell viability was expressed as percentage of cell survival in olaparib-treated cells relative to vehicle (DMSO)-treated cells. Results represent the mean ±SEM of at least three independent experiments, each performed in triplicate.

Immunofluorescence analyses

HeLa Fanci-/- cells were complemented with FLAG-FANCI variants and 0.1 µg of peGFP (when specified) as described above. HeLa Fanci+/+ cells were transfected with siRNA and complemented with siRNA resistant FANCI variants as described above. After 18 hours, cells were seeded on a glass coverslip for eight hours and then treated with 50 ng/ml MMC for 18 hours and processed for immunofluorescence with anti-Flag (Cell signaling Technologies, ref 8146, 1:1600) and anti-FANCD2 (Novus, ref NB100-182D1, 1:800) antibodies according to the protocol provided by Cell signaling technologies for Flag antibody. Alexa Fluor secondary antibodies from Life Technologies (ref A-11001, A-11004, A21235) were used at 1:1000. In HeLa Fanci-/- cells, FANCD2 foci were counted in GFP positive cells. In siRNA transfected cells, Flag positive cells were taken into consideration for the quantification of FANCD2 foci. Statistical analysis was performed using GraphPad Prism 8. Mean with SEM are shown, and a Kruskall-Wallis test was performed.

Anti-Flag pulldown assays

After siRNA transfection and complementation with Flag-FANCI WT or L605F, HeLa FANCI+/+ cells were lysed in lysis buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 0.5% NP-40) containing protease and phosphatase inhibitors (1 mM PMSF, 0.019TI U/ml aprotinin, 1 mg/ml leupeptin, 5 mM NaF, and 1mM Na3VO4) incubated for 30 minutes on ice, and lysed by sonication. Insoluble material was removed by high-speed centrifugation (13000 rpm at 4°C) and each immunoprecipitation (IP) was carried out using soluble protein extract in 1 ml of lysis buffer. Fifty ml of anti-Flag M2 affinity gel (Sigma) and 70 U of DNase I were added and incubated at 4°C for 2.5 hours. Beads were washed three times with washing buffer (50 mM Tris–HCl pH 7.5, 250 mM NaCl, 0.5% NP-40) and proteins were eluted with 60 µl of Laemmli buffer. Proteins were visualized by western blotting using the appropriate antibodies.

Differential FANCI protein expression by IHC analysis of HGSC tumours and normal tissues

Slides containing 4 micron slices of TMAs containing 0.6 mm FFPE tissue cores (spaced 0.2 mm apart) of HGSC (n=101)139 and normal fallopian tube (n=15) tissues, and FANCI c.1813C>T carrier tumour tissues (n=8) were stained using the BenchMark XT automated stainer (Ventana Medical System Inc., Roche). Antigen retrieval was carried out with Cell Conditioning 1 solution for one hour. The FANCI polyclonal antibody (Sigma HPA039972 dilution 1/200) was automatically dispensed and the TMAs were incubated at 37°C for one hour. The Ultra View DAB detection kit was used, and the slide was counterstained with hematoxylin. The TMAs were scanned with a 20× 0.75 NA objective by VS-110 Olympus.

Staining patterns were evaluated by two independent observers. Intensity of staining was scored for all cores using a four-point system; zero referring to no detectable staining to three referring to the highest staining intensity. As each sample was present in the TMA in duplicate, each case received four scores (two for the first core and two for the second core). The mode score was used for analysis where possible, otherwise the average score was used. The interobserver correlation for IHC analysis of the TMA of HGSC samples was 89%. Staining patterns and analyses from the TMA containing HGSC samples and normal fallopian tube samples were evaluated without prior knowledge of carrier status for FANCI c.1813C>T. All HGSC and normal fallopian tube samples were genotyped for FANCI c.1813C>T variant as described, and one previously known carrier was identified (PT0004). Samples that could not be scored were removed from further analysis (n=7 HGSC samples, n=2 FTE samples). A second TMA that contained 10 samples from eight FANCI c.1813C>T carriers (in duplicate) were also scored separately: the results from one sample from this TMA was removed from analysis due to poor tissue quality.

Spearman correlation was used to measure the strength of the correlation of staining intensity and survival data with clinical data as continuous variables. Survival curve was calculated according to Kaplan-Meier method coupled with a log rank test. Univariable Cox hazard models were used to estimate the hazard ratio as categorical data. All statistical analysis was done using Statistical Package for the Social Sciences software version 24., (SPSS, Inc) and results deemed statistically significance at p<0.05.

Data Availability

Unknown

Author contributions

C.T.F. performed targeted genetic experiments, bioinformatic and statistical analyses, wrote and edited initial drafts of the manuscript. L.G.-S. performed in vitro experiments and edited drafts of the manuscript. W.M.A aided in the bioinformatic analyses. T.R. and J.N. performed bioinformatic analyses and edited draft. K.K.O. performed genetic analyses. K.B. aided in experiments. S.L. A. aided in and oversaw experiments. S.B. performed targeted genotyping experiments. C.S. aided in study sample and clinical data collection. L.M. and H.F. performed immunohistochemistry of tissue microarray and associated statistical analyses. E.F., D.N.S., Z.E., and D.P. provided study samples, clinical data, and critical input. W.D.F and A.-M.M.-M. provided study samples and clinical data, critical input, and edited draft. J.M. oversaw whole exome sequencing and bioinformatic analyses of discovery family and edited draft. M.T., P.A.J., and I.G.C. provided genotyping and clinical data, critical input, and edited draft. C.M.T.G. oversaw bioinformatic analyses. J.R. oversaw processing of whole exome sequencing data, developed data analysis pipelines, and oversaw bioinformatic analyses. J.-Y.M. oversaw in vitro experiments. P.N.T. conceived and designed the overall project, wrote the manuscript, and oversaw all aspects of the project. All authors reviewed and edited the manuscript.

Competing interests

The authors declare no competing interests.

Acknowledgements

We thank Yan Coulombe, Dr. Amélie Rodrigue, and Dr. Faezeh Vasheghani Farahani for technical support, Dr. Lili Fu for reviewing pathology reports, Daryl A. Ronato for graphical support, and the Molecular Pathology core facility of the Centre de recherche du Centre hospitalier de l’Université de Montréal (CRCHUM) for performing the immunohistochemistry. C.T.F. was supported by The Research Institute of the McGill University Health Centre Studentship (RI-MUHC) Award and Ovarian Cancer Canada Trainee Travel (Research) Award. W.M.A. is supported by a Taibah University Scholarship Award and The Ministry of Higher Education, Saudi Arabia. H.F. was supported in part by the Michèle St-Pierre and Canderel fellowships of the Institut du cancer de Montréal. L.G.-S. is supported by a Fonds de recherche du Québec-Santé (FRQS) Fellowship Award and J.-Y.M. is a FRQS Research Chair in Genome Stability. The RI-MUHC and CRCHUM receive support from the FRQS. Research was supported by the following: The Canadian Institute for Health Research (CIHR) operating grants [PCC-156736 to P.N.T., C.M.T.G., J.R.; PJT-156124 to P.N.T., J.R.]; Cancer Research Society and Ovarian Cancer Canada partnership grant [21123 to P.N.T.; Department of Medicine, McGill University Grant to P.N.T.; FRQS and Quebec Breast Cancer Foundation network grants to P.N.T.; Compute Canada resource allocation project wst-164 and Genome Canada Genome Technology Platform award to J.R.; CIHR foundation grant to J.-Y.M. Ovarian tumor banking was supported by the Banque de tissus et de données of the Réseau de recherche sur le cancer of the FRQS affiliated with the Canadian Tumor Repository Network (CTRNet). Funding for BCAC and iCOGS came from: Cancer Research UK [grant numbers C1287/A16563, C1287/A10118, C1287/A10710, C12292/A11174, C1281/A12014, C5047/A8384, C5047/A15007, C5047/A10692, C8197/A16565], the European Union’s Horizon 2020 Research and Innovation Programme (grant numbers 634935 and 633784 for BRIDGES and B-CAST respectively), the European Community’s Seventh Framework Programme under grant agreement n° 223175 [HEALTHF2-2009-223175] (COGS), the National Institutes of Health [CA128978] and Post-Cancer GWAS initiative [1U19 CA148537, 1U19 CA148065-01 (DRIVE) and 1U19 CA148112 - the GAME-ON initiative], the Department of Defence [W81XWH-10-1-0341], and the Canadian Institutes of Health Research CIHR) for the CIHR Team in Familial Risks of Breast Cancer [grant PSR-SIIRI-701]. All studies and funders as listed in Michailidou K et al (2013 and 2015) and in Guo Q et al (2015) are acknowledged for their contributions.

References

  1. 1.↵
    Siegel, R. L., Miller, K. D. & Jemal, A. Cancer statistics, 2019. Ca. Cancer J. Clin. 69, 734 (2019).
    OpenUrl
  2. 2.↵
    Lichtenstein, P. et al. Environmental and heritable factors in the causation of cancer: Analyses of cohorts of twins from Sweden, Denmark, and Finland. N. Engl. J. Med. 343, 78–85 (2000).
    OpenUrlCrossRefPubMedWeb of Science
  3. 3.↵
    Lynch, J. F., Butts, M., Godwin, A. K. & Ph, D. Hereditary Ovarian Cancer: Molecular Genetics, Pathology, Management, and Heterogeneity. Mol. Oncol. 3, 97–137 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  4. 4.↵
    Stratton, J. F., Pharoah, P., Smith, S. K., Easton, D. & Ponder, B. a. A systematic review and meta-analysis of family history and risk of ovarian cancer. Br. J. Obstet. Gynaecol. 105, 493–499 (1998).
    OpenUrlCrossRefPubMedWeb of Science
  5. 5.↵
    Kuchenbaecker, K. B. et al. Risks of breast, ovarian, and contralateral breast cancer for BRCA1 and BRCA2 mutation carriers. JAMA 317, 2402–2416 (2017).
    OpenUrlCrossRefPubMed
  6. 6.↵
    Peres, L. C. et al. Invasive epithelial ovarian cancer survival by histotype and disease stage. J. Natl. Cancer Inst. 111, 60–68 (2019).
    OpenUrlPubMed
  7. 7.↵
    Vang, R., Shih, L. M. & Kurman, R. J. Ovarian low-grade and high grade serous carcinoma: Pathogenesis, clinicopathologic and molecular biologic features, and diagnostic problems. Adv. Anat. Pathol. 16, 267–282 (2009).
    OpenUrlCrossRefPubMedWeb of Science
  8. 8.↵
    Mucci, L. A. et al. Familial risk and heritability of cancer among twins in nordic countries. JAMA 315, 68–76 (2016).
    OpenUrlCrossRefPubMed
  9. 9.↵
    Finch, A. P. M. et al. Impact of oophorectomy on cancer incidence and mortality in women with a BRCA1 or BRCA2 mutation. J. Clin. Oncol. 32, 1547–1554 (2014).
    OpenUrlAbstract/FREE Full Text
  10. 10.↵
    Finch, A. et al. Salpingo-oophorectomy and the risk of ovarian, fallopian tube, and peritoneal cancers in women with a BRCA1 or BRCA2 mutation. JAMA 296, 185–192 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  11. 11.↵
    Fong, P. C. et al. Poly (ADP)-ribose polymerase inhibition: Frequent durable responses in BRCA carrier ovarian cancer correlating with platinum-free interval. J. Clin. Oncol. 28, 2512–2519 (2010).
    OpenUrlAbstract/FREE Full Text
  12. 12.
    Audeh, M. W. et al. Oral poly (ADP-ribose) polymerase inhibitor olaparib in patients with BRCA1 or BRCA2 mutations and recurrent ovarian cancer: a proof-of-concept trial. Lancet Oncol. 376, 245–251 (2010).
    OpenUrlCrossRef
  13. 13.
    Gelmon, K. A. et al. Olaparib in patients with recurrent high-grade serous or poorly differentiated ovarian carcinoma or triple-negative breast cancer: a phase 2, multicentre, open-label, non-randomised study. Lancet Oncol. 12, 852–861 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  14. 14.
    Kaufman, B. et al. Olaparib monotherapy in patients with advanced cancer and a germline BRCA1/2 mutation. J. Clin. Oncol. 33, 244–250 (2015).
    OpenUrlAbstract/FREE Full Text
  15. 15.
    Pujade-lauraine, E. et al. Olaparib tablets as maintenance therapy in patients with platinum-sensitive, relapsed ovarian cancer and a BRCA1/2 randomised, placebo-controlled, phase 3 trial. Lancet Oncol. 18, 1274–1284 (2017).
    OpenUrlCrossRefPubMed
  16. 16.↵
    Ledermann, J. et al. Olaparib maintenance therapy in patients with platinum-sensitive relapsed serous ovarian cancer: a preplanned retrospective analysis of outcomes by BRCA status in a randomised phase 2 trial. Lancet Oncol. 15, 852–861 (2014).
    OpenUrlCrossRefPubMedWeb of Science
  17. 17.↵
    Kanchi, K. L. et al. Integrated analysis of germline and somatic variants in ovarian cancer. Nat. Commun. 5, 3156 (2014).
    OpenUrlCrossRefPubMed
  18. 18.↵
    Song, H. et al. Tagging single nucleotide polymorphisms in the BRIP1 gene and susceptibility to breast and ovarian cancer. PLoS One 2, e268 (2007).
    OpenUrlCrossRefPubMed
  19. 19.↵
    Rafnar, T. et al. Mutations in BRIP1 confer high risk of ovarian cancer. Nat. Genet. 43, 1104–1107 (2011).
    OpenUrlCrossRefPubMed
  20. 20.↵
    Meindl, A. et al. Germline mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer susceptibility gene. Nat. Genet. 42, 410–414 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  21. 21.↵
    Zheng, Y. et al. Screening RAD51C nucleotide alterations in patients with a family history of breast and ovarian cancer. Breast Cancer Res. Treat. 124, 857–861 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  22. 22.
    Bagley, C. M., Young, R. C., Canellos, G. P. & DeVita, V. T. Treatment of ovarian carcinoma: Possibilities for progress. N. Engl. J. Med. 287, 856–862 (1972).
    OpenUrlPubMedWeb of Science
  23. 23.↵
    Somyajit, K., Subramanya, S. & Nagaraju, G. RAD51C: A novel cancer susceptibility gene is linked to Fanconi anemia and breast cancer. Carcinogenesis 31, 2031–2038 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  24. 24.↵
    Loveday, C. et al. Germline mutations in RAD51D confer susceptibility to ovarian cancer. Nat. Genet. 43, 879–882 (2011).
    OpenUrlCrossRefPubMed
  25. 25.↵
    Yang, X. et al. Ovarian and breast cancer risks associated with pathogenic variants in RAD51C and RAD51D. J. Natl. Cancer Inst. djaa030, https://doi.org/10.1093/jnci/djaa030 (2020).
  26. 26.↵
    Scriver, C. R. Human genetics: Lessons from Quebec populations. Annu. Rev. Genomics Hum. Genet. 2, 69–101 (2001).
    OpenUrlCrossRefPubMedWeb of Science
  27. 27.↵
    Laberge, A.-M. et al. Population history and its impact on medical genetics in Quebec. Clin Genet 68, 287–301 (2005).
    OpenUrlCrossRefPubMedWeb of Science
  28. 28.
    Roy-Gagnon, M.-H. et al. Genomic and genealogical investigation of the French Canadian founder population structure. Hum. Genet. 129, 521–531 (2011).
    OpenUrlCrossRefPubMed
  29. 29.↵
    Bherer, C. et al. Admixed ancestry and stratification of Quebec regional populations. Am. J. Phys. Anthropol. 144, 432–441 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  30. 30.↵
    Oros, K. K. et al. Significant proportion of breast and/or ovarian cancer families of French Canadian descent harbor 1 of 5 BRCA1 and BRCA2 mutations. Int. J. Cancer 112, 411–419 (2004).
    OpenUrlCrossRefPubMedWeb of Science
  31. 31.↵
    Cline, M. S. et al. BRCA Challenge: BRCA Exchange as a global resource for variants in BRCA1 and BRCA2. PLoS Genet. 14, e1007752 (2018).
    OpenUrlCrossRefPubMed
  32. 32.↵
    Tischkowitz, M. et al. Contribution of the PALB2 c.2323C>T [p. Q775X] Founder mutation in well-defined breast and/or ovarian cancer families and unselected ovarian cancer cases of French Canadian descent. BMC Med. Genet. 14, 5 (2013).
    OpenUrlCrossRefPubMed
  33. 33.↵
    Rivera, B. et al. Functionally null RAD51D missense mutation associates strongly with ovarian carcinoma. Cancer Res. 77, 4517–4529 (2017).
    OpenUrlAbstract/FREE Full Text
  34. 34.↵
    Sims, A. E. et al. FANCI is a second monoubiquitinated member of the Fanconi anemia pathway. Nat. Struct. Mol. Biol. 14, 564–567 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  35. 35.↵
    Smogorzewska, A. et al. Identification of the Fanconi anemia (FANC) I protein, a monoubiquitinated FANCD2 paralog required for crosslink repair. Cell 129, 289–301 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  36. 36.↵
    Dorsman, J. C. et al. Identification of the Fanconi anemia complementation group I gene, FANCI. Cell. Oncol. 29, 211–218 (2007).
    OpenUrlPubMedWeb of Science
  37. 37.↵
    Ishiai, M. et al. FANCI phosphorylation functions as a molecular switch to turn on the Fanconi anemia pathway. Nat. Struct. Mol. Biol. 15, 1138–1146 (2008).
    OpenUrlCrossRefPubMedWeb of Science
  38. 38.↵
    Nakanishi, K. et al. Human Fanconi anemia monoubiquitination pathway promotes homologous DNA repair. PNAS 102, 1110–1115 (2005).
    OpenUrlAbstract/FREE Full Text
  39. 39.↵
    Tonin, P. N., Maugard, C. M., Perret, C., Mes-Masson, A. M. & Provencher, D. M. A review of histopathological subtypes of ovarian cancer in BRCA-related French Canadian cancer families. Fam. Cancer 6, 491–497 (2007).
    OpenUrlPubMed
  40. 40.↵
    Evans, D. G. R. et al. A new scoring system for the chances of identifying a BRCA1/2 mutation outperforms existing models including BRCAPRO. J Med Genet 41, 474–480 (2004).
    OpenUrlAbstract/FREE Full Text
  41. 41.↵
    Evans, D. G. et al. Pathology update to the Manchester Scoring System based on testing in over 4000 families. J Med Genet 54, 674–681 (2017).
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    Oros, K. K. et al. Application of BRCA1 and BRCA2 mutation carrier prediction models in breast and/or ovarian cancer families of French Canadian descent. Clin. Genet. 70, 320–329 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  43. 43.↵
    Davydov, E. V, Goode, D. L., Sirota, M., Cooper, G. M. & Sidow, A. Identifying a high fraction of the human genome to be under selective constraint using GERP ++. PLoS Comput. Biol. 6, e1001025 (2010).
    OpenUrlCrossRefPubMed
  44. 44.↵
    Adzhubei, I. A. et al. A method and server for predicting damaging missense mutations. Nat. Methods 7, 248–249 (2010).
    OpenUrlCrossRefPubMedWeb of Science
  45. 45.↵
    1000 Genomes Project Consortium et al. A global reference for human genetic variation. Nature 526, 68–74 (2015).
    OpenUrlCrossRefPubMed
  46. 46.↵
    Belanger, M. H. et al. A targeted analysis identifies a high frequency of BRCA1 and BRCA2 mutation carriers in women with ovarian cancer from a founder population. J. Ovarian Res. 8, 1 (2015).
    OpenUrlCrossRefPubMed
  47. 47.↵
    Oros, K. K. et al. Haplotype analysis suggest common founder in carriers of recurrent BRCA2 mutation, 3398delAAAAG, in French Canadian hereditary breast and/ovarian cancer families. BMC Med. Genet. 7, 23 (2006).
    OpenUrlPubMed
  48. 48.↵
    Tonin, P. N. et al. Founder BRCA1 and BRCA2 mutations in French Canadian breast and ovarian cancer families. Am. J. Hum. Genet. 63, 1341–1351 (1998).
    OpenUrlCrossRefPubMedWeb of Science
  49. 49.↵
    Tonin, P. N., Mes-Masson, A. M., Narod, S. A., Ghadirian, P. & Provencher, D. Founder BRCA1 and BRCA2 mutations in French Canadian ovarian cancer cases unselected for family history. Clin Genet 55, 318–324 (1999).
    OpenUrlCrossRefPubMedWeb of Science
  50. 50.
    Tonin, P. N. et al. Founder BRCA1 and BRCA2 mutations in early-onset french Canadian breast cancer cases unselected for family history. Int. J. Cancer 95, 189–193 (2001).
    OpenUrlCrossRefPubMed
  51. 51.↵
    Arcand, S. L. et al. Germline TP53 mutational spectrum in French Canadians with breast cancer. BMC Med. Genet. 16, 24 (2015).
    OpenUrl
  52. 52.
    Novak, D. J. et al. Identification of a novel CHEK2 variant and assessment of its contribution to the risk of breast cancer in French Canadian women. BMC Cancer 8, 239 (2008).
    OpenUrlPubMed
  53. 53.
    Tischkowitz, M. et al. Analysis of PALB2/FANCN-associated breast cancer families. PNAS 104, 6788–6793 (2007).
    OpenUrlAbstract/FREE Full Text
  54. 54.
    Cote, S. et al. The BRCA2 c. 9004G>A (E2003K) variant is likely pathogenic and recurs in breast and/or ovarian cancer families of French Canadian descent. Breast Cancer Res. Treat. 131, 333–340 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  55. 55.↵
    Osher, D. J. et al. Mutation analysis of RAD51D in non-BRCA1/2 ovarian and breast cancer families. Br. J. Cancer 106, 1460–1463 (2012).
    OpenUrlPubMed
  56. 56.↵
    Arcand, S. L. et al. Germline TP53 mutations in BRCA1 and BRCA2 mutation-negative French Canadian breast cancer families. Breast Cancer Res. Treat. 108, 399–408 (2008).
    OpenUrlCrossRefPubMed
  57. 57.
    Cavallone, L. et al. Haplotype analysis of TP53 polymorphisms, Arg72Pro and Ins16, in BRCA1 and BRCA2 mutation carriers of French Canadian descent. BMC Cancer 8, 96 (2008).
    OpenUrlCrossRefPubMed
  58. 58.
    Cavallone, L. et al. Comprehensive BRCA1 and BRCA2 mutation analyses and review of French Canadian families with at least three cases of breast cancer. Fam. Cancer 9, 507–517 (2010).
    OpenUrlPubMed
  59. 59.↵
    Godard, B. et al. Risk factors for familial and sporadic ovarian cancer among French Canadians: A case-control study. Am. J. Obstet. Gynecol. 179, 403–410 (1998).
    OpenUrlCrossRefPubMedWeb of Science
  60. 60.↵
    Awadalla, P. et al. Cohort profile of the CARTaGENE study: Quebec’s population-based biobank for public health and personalized genomics. Int. J. Epidemiol. 42, 1285–1299 (2013).
    OpenUrlCrossRefPubMedWeb of Science
  61. 61.↵
    Lek, M. et al. Analysis of protein-coding genetic variation in 60,706 humans. Nature 536, 285–291 (2016).
    OpenUrlCrossRefPubMedWeb of Science
  62. 62.↵
    Matulonis, U. A. et al. Ovarian cancer. Nat. Rev. Dis. Prim. 2, 16061 (2016).
    OpenUrl
  63. 63.↵
    Reid, B. M., Permuth, J. B. & Sellers, T. A. Epidemiology of ovarian cancer: A summary review. Cancer Biol Med 14, 9–32 (2017).
    OpenUrlCrossRefPubMed
  64. 64.↵
    Rice, M. S., Hankinson, S. E. & Tworoger, S. S. Tubal ligation, hysterectomy, unilateral oophorectomy, and risk of ovarian cancer in the Nurses’ Health Studies. Fertil Steril 102, 192–198 (2014).
    OpenUrlCrossRefPubMed
  65. 65.
    Rebbeck, T. R. et al. Prophylactic oophorectomy in carriers of BRCA1 or BRCA2 mutations. N. Engl. J. Med. 346, 1616–1622 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  66. 66.
    Joly, D. J., Lilienfeld, A. M., Diamond, E. L. & Bross, I. D. J. An epidemiologic study of the relationship of reproductive experience to cancer of the ovary. Am. J. Epidemiol. 99, 190–209 (1974).
    OpenUrlPubMedWeb of Science
  67. 67.
    Casagrande, J. T. et al. “Incessant ovulation” and ovarian cancer. Lancet 314, 170–173 (1979).
    OpenUrl
  68. 68.
    Nasca, P. C., Greenwald, P., Chorost, S., Richart, R. & Caputo, T. An epidemiologic case-control study of ovarian cancer and reproductive factors. Am. J. Epidemiol. 119, 705–713 (1984).
    OpenUrlPubMedWeb of Science
  69. 69.
    The Cancer and Steroid Hormone Study of the Centers for Disease Control and the National Institute of Child Health and Human Development. The reduction in risk of ovarian cancer associated with oral-contraceptive use. N. Engl. J. Med. 316, 650–655 (1987).
    OpenUrlCrossRefPubMedWeb of Science
  70. 70.↵
    Moorman, P. G. et al. Oral contraceptives and risk of ovarian cancer and breast cancer among high-risk women: A systematic review and meta-analysis. J. Clin. Oncol. 31, 4188–4198 (2013).
    OpenUrlAbstract/FREE Full Text
  71. 71.
    Rosenberg, L. et al. A case-control study of oral contraceptive use and invasive epithelial ovarian cancer. Am. J. Epidemiol. 139, 654–661 (1994).
    OpenUrlPubMedWeb of Science
  72. 72.
    Mori, M. et al. Reproductive, genetic, and dietary risk factors for ovarian cancer. Am. J. Epidemiol. 128, 771–777 (1988).
    OpenUrlPubMedWeb of Science
  73. 73.↵
    Hankinson, S. E. et al. Tubal ligation, hysterectomy, and risk of ovarian cancer. JAMA 270, 2813–2818 (1993).
    OpenUrlCrossRefPubMedWeb of Science
  74. 74.↵
    Subramanian, D. N. et al. Exome sequencing of familial high-grade serous ovarian carcinoma reveals heterogeneity for rare candidate susceptibility genes. Nat. Commun. 11, https://doi.org/10.1038/s41467-020-15461-z (2020).
  75. 75.↵
    Phelan, C. M. et al. Identification of 12 new susceptibility loci for different histotypes of epithelial ovarian cancer. Nat. Genet. 49, 680–691 (2017).
    OpenUrlCrossRefPubMed
  76. 76.↵
    Michailidou, K. et al. Large-sclae genotyping identified 41 new loci associated with breast cancer risk. Nat. Genet. 45, 353–361 (2013).
    OpenUrlCrossRefPubMed
  77. 77.↵
    Michailidou, K. et al. Genome-wide association analysis of more than 120,000 individuals identifies 15 new susceptibility loci for breast cancer. Nat. Genet. 47, 373–380 (2015).
    OpenUrlCrossRefPubMed
  78. 78.↵
    Lakhani, S. R. et al. Pathology of ovarian cancers in BRCA1 and BRCA2 carriers. Clin. Cancer Res. 10, 2473–2481 (2004).
    OpenUrlAbstract/FREE Full Text
  79. 79.
    Evans, D. et al. Probability of BRCA1/2 mutation varies with ovarian histology: results from screening 442 ovarian cancer families. Clin. Genet. 73, 338–345 (2008).
    OpenUrlCrossRefPubMed
  80. 80.
    Bolton, K. L. et al. Association between BRCA1 and BRCA2 mutations and survival in women with invasive epithelial ovarian cancer. JAMA 307, 382–390 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  81. 81.↵
    Liu, J. et al. Clinical characteristics and outcomes of BRCA-associated ovarian cancer: genotype and survival. Cancer Genet. 205, 34–41 (2012).
    OpenUrlCrossRefPubMedWeb of Science
  82. 82.↵
    PDQ Cancer Genetics Editorial Board. Genetics of breast and gynecologic cancers (PDQ®): health professional version. PDQ Cancer Information Summaries (National Cancer Institute (US)).
  83. 83.↵
    Kindelberger, D. W. et al. Intraepithelial carcinoma of the fimbria and pelvic serous carcinoma: Evidence for a causal relationship. Am. J. Surg. Pathol. 31, 161–169 (2007).
    OpenUrlCrossRefPubMedWeb of Science
  84. 84.
    Callahan, M. J. et al. Primary fallopian tube malignancies in BRCA-positive women undergoing surgery for ovarian cancer risk reduction. J. Clin. Oncol. 25, 3985–3990 (2007).
    OpenUrlAbstract/FREE Full Text
  85. 85.
    Carlson, J. W. et al. Serous tubal intraepithelial carcinoma: Its potential role in primary peritoneal serous carcinoma and serous cancer prevention. J. Clin. Oncol. 26, 4160–4165 (2008).
    OpenUrlAbstract/FREE Full Text
  86. 86.
    Finch, A. et al. Clinical and pathologic findings of prophylactic salpingo-oophorectomies in 159 BRCA1 and BRCA2 carriers. Gynecol. Oncol. 100, 58–64 (2006).
    OpenUrlCrossRefPubMedWeb of Science
  87. 87.
    Labidi-galy, S. I. et al. High grade serous ovarian carcinomas originiate in the fallopian tube. Nat. Commun. 8, (2017).
  88. 88.
    Leeper, K. et al. Pathologic findings in prophylactic oophorectomy specimens in high-risk women. Gynecol. Oncol. 87, 52–56 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  89. 89.↵
    Powell, C. B. et al. Risk-reducing salpingo-oophorectomy in BRCA mutation carriers: role of seial sectioning in the setection of occult malignancy. J. Clin. Oncol. 23, 127–132 (2005).
    OpenUrlAbstract/FREE Full Text
  90. 90.↵
    Foulkes, W. D. et al. Identification of a novel truncating PALB2 mutation and analysis of its contribution to early-onset breast cancer in French-Canadian women. Breast Cancer Res. 9, R83 (2007).
    OpenUrlCrossRefPubMed
  91. 91.↵
    Castellsague, E. et al. Characterization of a novel founder MSH6 mutation causing Lynch syndrome in the French Canadian population. Clin. Genet. 87, 536–542 (2015).
    OpenUrl
  92. 92.↵
    Vezina, H. et al. Molecular and genealogical characterization of the R1443X BRCA1 mutation in high-risk French-Canadian breast/ovarian cancer families. Hum. Genet. 117, 119–132 (2005).
    OpenUrlCrossRefPubMed
  93. 93.↵
    Manning, A. P. et al. Haplotype analysis of BRCA2 8765delAG mutation carriers in French Canadian Yemenite Jewish hereditary breast cancer families. Hum. Hered. 52, 116–120 (2001).
    OpenUrlPubMed
  94. 94.↵
    Wojnarowicz, P. M. et al. The Genomic Landscape of TP53 and p53 Annotated High Grade Ovarian Serous Carcinomas from a Defined Founder Population Associated with Patient Outcome. PLoS One 7, e45484 (2012).
    OpenUrlCrossRefPubMed
  95. 95.↵
    The Cancer Genome Atlas Network. Integrated genomic analyses of ovarian carcinoma. Nature 474, 609–615 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  96. 96.↵
    Maxwell, K. N. et al. BRCA locus-specific loss of heterozygosity in germline BRCA1 and BRCA2 carriers. Nat. Commun. 8, 319 (2017).
    OpenUrlPubMed
  97. 97.↵
    Vahteristo, P. et al. A CHEK2 genetic variant contributing to a substantial fraction of familial breast cancer. Am. J. Hum. Genet. 71, 432–438 (2002).
    OpenUrlCrossRefPubMedWeb of Science
  98. 98.↵
    Weber-Lassalle, N. et al. BRIP1 loss-of-function mutations confer high risk for familial ovarian cancer, but not familial breast cancer. Breast Cancer Res. 20, 7 (2018).
    OpenUrlCrossRef
  99. 99.↵
    Lin, P.-H. et al. Multiple gene sequencing for risk assessment in patients with early-onset or familial breast cancer. Oncotarget 7, 8310–8320 (2016).
    OpenUrlPubMed
  100. 100.
    Girard, E. et al. Familial breast cancer and DNA repair genes: insights into known and novel susceptibility genes from the GENESIS study, and implications for multigene panel testing. Int. J. Cancer 144, 1962–1974 (2018).
    OpenUrl
  101. 101.↵
    Garcia, M. J. et al. Mutational analysis of FANCL, FANCM and the recently identified FANCI suggests that among the 13 known Fanconi anemia genes, only FANCD1/BRCA2 plays a major role in high-risk breast cancer predisposition. Carcinogenesis 30, 18981902 (2009).
    OpenUrl
  102. 102.
    Ellingson, M. S. et al. Exome sequencing reveals frequent deleterious germline variants in cancer susceptibility genes in women with invasive breast cancer undergoing neoadjuvant chemotherapy. Breast Cancer Res. Treat. 153, 435–443 (2015).
    OpenUrl
  103. 103.↵
    Yang, X. et al. Identification of a comprehensive spectrum of genetic factors for hereditary breast cancer in a Chinese population by next-generation sequencing. PLoS One 10, e0125571 (2015).
    OpenUrl
  104. 104.↵
    Mantere, T. et al. Finnish Fanconi anemia mutations and hereditary predisposition to breast and prostate cancer. Clin Genet 88, 68–73 (2015).
    OpenUrl
  105. 105.↵
    Bonache, S. et al. Multigene panel testing beyond BRCA1/2 in breast/ovarian cancer Spanish families and clinical actionability of findings. J. Cancer Res. Clin. Oncol. 144, 2495–2513 (2018).
    OpenUrlCrossRef
  106. 106.↵
    Tedaldi, G. et al. Multiple-gene panel analysis in a case series of 255 women with hereditary breast and ovarian cancer. Oncotarget 8, 47064–47075 (2017).
    OpenUrlCrossRef
  107. 107.↵
    Paulo, P. et al. Targeted next generation sequencing identifies functionally deleterious germline mutations in novel genes in early-onset/familial prostate cancer. PLoS Genet. 14, e1007355 (2018).
    OpenUrlCrossRef
  108. 108.↵
    Velho, P. I. et al. Efficacy of radium-223 in bone-metastatic castration-resistant prostate cancer with and without homologous repair gene defects. Eur. Urol. 76, 170–176 (2018).
    OpenUrl
  109. 109.↵
    Chan, S. H. et al. Germline mutations in cancer predisposition genes are frequent in sporadic sarcomas. Sci. Rep. 7, 10660 (2017).
    OpenUrlCrossRef
  110. 110.↵
    Betti, M. et al. Germline mutations in DNA repair genes predispose asbestos-exposed patients to malignant pleural mesothelioma. Cancer Lett. 405, 38–45 (2017).
    OpenUrl
  111. 111.↵
    Maung, K. Z. Y. et al. Rare variants in Fanconi anemia genes are enriched in acute myeloid leukemia. Blood Cancer J. 8, https://doi.org/10.1038/s41408-018-0090-7 (2018).
  112. 112.↵
    Chandrasekharappa, S. C. et al. Assessing the spectrum of germline variation in Fanconi anemia genes among patients with head and neck carcinoma before age 50. Cancer 123, 3943–3954 (2017).
    OpenUrl
  113. 113.↵
    Zhunussova, G. et al. Mutation spectrum of cancer-associated genes in patients with early onset of colorectal cancer. Front. Oncol. 9, https://doi.org/10.3389/fonc.2019.00673 (2019).
  114. 114.↵
    Castella, M. et al. FANCI regulates recruitment of the FA core complex at sites of DNA damage independently of FANCD2. PLoS Genet. 11, e1005563 (2015).
    OpenUrlCrossRefPubMed
  115. 115.↵
    Niraj, J., Farkkila, A. & D’Andrea, A. D. The Fanconi anemia pathway in cancer. Annu Rev Cancer Biol 3, 457–478 (2019).
    OpenUrlCrossRefPubMed
  116. 116.↵
    Farmer, H. et al. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy. Nature 434, 917–921 (2005).
    OpenUrlCrossRefPubMedWeb of Science
  117. 117.
    Wiltshire, T. et al. Functional characterization of 84 PALB2 variants of uncertain significance. Genet. Med. 22, 622–632 (2019).
    OpenUrl
  118. 118.↵
    Rodrigue, A. et al. A global functional analysis of missense mutations reveals two major hotspots in the PALB2 tumor suppressor. Nucleic Acids Res. 47, 10662–10677 (2019).
    OpenUrl
  119. 119.↵
    Kim, Y. et al. Regulation of multiple DNA repair pathways by the Fanconi anemia protein SLX4. Blood 121, 54–64 (2013).
    OpenUrlAbstract/FREE Full Text
  120. 120.↵
    Chatterjee, N., Lin, Y. & Wilson, J. H. Fanconi anemia pathway regulates convergent trancription-induced cell death at trinucleotide repeats in human cells. Postdoc J. 4, 4654 (2016).
    OpenUrl
  121. 121.
    Chen, Y. et al. ATR-mediated phosphorylation of FANCI regulates dormant origin firing in response to replication stress. Mol. Cell 58, 323–338 (2016).
    OpenUrl
  122. 122.
    Sato, K. et al. FANCI-FANCD2 stabilizes the RAD51-DNA complex by binding RAD51 and protects the 5’-DNA end. Nucleic Acids Res. 44, 10758–10771 (2016).
    OpenUrlCrossRefPubMed
  123. 123.
    Zhang, X., Lu, X., Akhter, S., Georgescu, M. & Legerski, R. J. FANCI is a negative regulator of Akt activation. Cell Cycle 15, 1134–1143 (2016).
    OpenUrl
  124. 124.↵
    Sondalle, S. B., Longerich, S., Ogawa, L. M., Sung, P. & Baserga, S. J. Fanconi anemia protein FANCI functions in ribosome biogenesis. PNAS 116, 2561–2570 (2019).
    OpenUrlAbstract/FREE Full Text
  125. 125.↵
    Mehta, P. A., & Tolar, J. Fanconi Anemia. in GeneReviews(®) [Internet] (eds. Pagon, R., Adam, M. & Ardinger, H.) (Seattle (WA): University of Washington, Seattle, 2002).
  126. 126.↵
    Dubois, E. L. et al. A Fanci knockout mouse model reveals common and distinct functions for FANCI and FANCD2. Nucleic Acids Res. 47, 7532–7547 (2019).
    OpenUrl
  127. 127.↵
    Yang, H. & Wang, K. Genomic variant annotation and prioritization with ANNOVAR and wANNOVAR. Nat. Protoc. 10, 1556–1566 (2015).
    OpenUrlCrossRefPubMed
  128. 128.↵
    Sim, N. et al. SIFT web server: predicting effects of amino acid substitutions on proteins. Nucleic Acids Res. 40, 452–457 (2012).
    OpenUrlCrossRef
  129. 129.↵
    Robinson, J. T. et al. Integrative Genomics Viewer. Nat. Biotechnol. 29, 24–26 (2011).
    OpenUrlCrossRefPubMedWeb of Science
  130. 130.↵
    Knijnenburg, T. A. et al. Genomic and molecular landscape of DNA damage repair deficiency across The Cancer Genome Atlas resource. Cell Rep. 23, 239–254 (2018).
    OpenUrlCrossRefPubMed
  131. 131.↵
    Behl, S. et al. Founder BRCA1/BRCA2/PALB2 pathogenic variants in French-Canadian breast cancer cases and controls. Sci. Rep. 10, https://doi.org/10.1038/s41598-020-63100-w (2020).
  132. 132.
    Fedick, A. et al. High-throughput carrier screening using TaqMan allelic discrimination. PLoS One 8, e59722 (2013).
    OpenUrlCrossRefPubMed
  133. 133.
    Mccarthy, S. et al. A reference panel of 64,976 haplotypes for genotype imputation. Nat. Genet. 48, 1279–1283 (2016).
    OpenUrlCrossRefPubMed
  134. 134.↵
    Loh, P. et al. Reference-based phasing using the Haplotype Reference Consortium panel. Nat. Genet. 48, 1443–1448 (2016).
    OpenUrlCrossRefPubMed
  135. 135.↵
    Durbin, R. Efficient haplotype matching and storage using the positional Burrows-Wheeler transform (PBWT). Bioinformatics 30, 1266–1272 (2014).
    OpenUrlCrossRefPubMedWeb of Science
  136. 136.↵
    Mclaren, W. et al. The Ensembl Variant Effect Predictor. Genome Biol. 17, http://dx.doi.org/10.1186/s13059-016-0974-4 (2016).
  137. 137.↵
    Rowley, S. M. et al. Population-based genetic testing of asymptomatic women for breast and ovarian cancer susceptibility. Genet. Med. 21, 913–922 (2018).
    OpenUrl
  138. 138.↵
    Berry, B. D. A. et al. BRCAPRO validation, sensitivity of genetic testing of BRCA1/BRCA2, and prevalence of other breast cancer susceptibility genes. J. Clin. Oncol. 20, 2701–2712 (2002).
    OpenUrlAbstract/FREE Full Text
  139. 139.↵
    Medrano, M. et al. Interrogation of functional cell-surface markers identifies CD151 dependency in high-grade serous ovarian cancer. Cell Rep. 18, 2343–2358 (2017).
    OpenUrlCrossRef
Back to top
Posted May 08, 2020.
Download PDF

Supplementary Material

Data/Code
Email
The genetic analysis of a founder Northern American population of European descent identifies FANCI as a candidate familial ovarian cancer risk gene
Caitlin T Fierheller, Laure Guitton-Sert, Wejdan M Alenezi, Timothée Revil, Kathleen K Oros, Karine Bedard, Suzanna L Arcand, Corinne Serruya, Supriya Behl, Liliane Meunier, Hubert Fleury, Eleanor Fewings, Deepak N Subramanian, Javad Nadaf, Diane Provencher, William D Foulkes, Zaki El Haffaf, Anne-Marie Mes-Masson, Jacek Majewski, Marc Tischkowitz, Paul A James, Ian G Campbell, Celia M T Greenwood, Jiannis Ragoussis, Jean-Yves Masson, Patricia N Tonin
medRxiv 2020.05.04.20090407; doi: https://doi.org/10.1101/2020.05.04.20090407
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area