Whole Exome Sequencing characterization of Maturity-Onset Diabetes of the Young (MODY) and Type 2 Diabetes Mellitus patients reveals polygenic features and novel genetic variants of risk for MODY in a Latino population

Alberto Moscona-Nissan, Daniel Marrero-Rodríguez, Sergio Andonegui-Elguera, Eduardo Salif Luna-Ávila, Florencia Martínez-Mendoza, Sandra Vela-Patiño, Itzel Ramírez-Ramos, Kapy S León-Wu, Regina De Miguel-Ibáñez, Moisés Mercado, Keiko Taniguchi-Ponciano, Aldo Ferreira-Hermosillo
doi: https://doi.org/10.1101/2024.10.02.24314794

Abstract

MODY is a heterogeneous group of monogenic forms of diabetes which present autosomal dominant inheritance in most cases, early onset, and lack of beta-cell autoimmunity. Up to 14 types of MODY have been described in genes with key roles in beta-cell differentiation, insulin secretion, and glucose metabolism. MODY misdiagnosis remains widespread, due to overlapping clinical phenotypes and remarkable variability within genetic variants across populations. Whole Exome Sequencing (WES) studies are needed to identify new genes in non-caucasian populations, as up to 77% of non-caucasian MODY patients do not harbor variants of significance in MODY-known genes. We characterized the genetic landscape of Mexican patients with MODY through WES, comparing data with T2DM and healthy subjects and proposed a novel set of genes in MODY in a Latino population.

We enrolled 51 participants divided into 3 groups, each comprising 17 subjects. Among MODY 1-14 genes, ABCC8, CEL, BLK and HNF1A genes presented the highest burden of variants across patients and found statistically significant differences in variant frequencies across groups in 5.3% of total variants. The only pathogenic variant in MODY cases that reached statistical significance (p<0.001) across all groups was c.C1226T:p.T409I in CEL gene (deleterious by SIFT and probably damaging by PolyPhen) as was present in 58.9% of MODY patients, while in 0% of T2DM and healthy subjects. We detected other frequent pathogenic, possibly/probably damaging, deleterious, or CIP variants in Mexican MODY cases in genes such as HNF1A (c.A79C:p.I27L), and APPL1 (c.A2099G:p.E700G) in 64.7% and 23.5% of MODY patients, respectively, but at similar frequencies in T2DM and healthy controls. The CEL pathogenic variants c.T2059G:p.S687A and c.G2065C:p.A689P were exclusively detected in 11.8% of MODY cases, while additional pathogenic variants in GCK, NEUROD1, PAX4, ABCC8, KCNJ11, and BLK were detected in 5.9% of cases.

Upon analyzing MODY patients individually, we unveiled the presence of one or more pathogenic/likely pathogenic/deleterious/CIP variants in 15/17 (88%) patients, and no variants in 12%. However, among those 15 cases, 12 patients presented two or more concomitant pathogenic/likely pathogenic/deleterious/CIP variants, revealing polygenic features in Mexican MODY patients.

WES mutational analysis revealed global and specific differences and differential enrichment in genes across groups. We propose a set of 15 candidate genes (KCNJ2, OR2A1, RIMBP3, TRIM49C, CLEC18B, OR2T5, PEX5, AQP12B, OR51A4, SYT15, TRIM64, GSTT2B, SUSD2, TPTE, ZNF814) which are significantly (p<0.01) enriched in Mexican MODY patients and not in T2DM and healthy subjects, and 12 genes significantly enriched in Mexican T2DM and healthy groups, while not in MODY cases (ABC7, ASAH2, OR2A42, RIMBP3C, NBPF6, PGA3, GOLGA8N, PABPC1, PABPC3, CNTNAP3B, POTEM, SPIN2A).

Upon analysis of exclusively high impact variants and considering a cutoff value of an adjusted p<0.01, we propose a set of 4 genes (MAP2K3, PEX5, KMT2C, and ZNF717) enriched in the MODY group when compared to both T2DM and healthy subjects and 10 genes (ABC7, MUC6, PLIN4, OR8U1, NBPF11, PABPC3, RBMX, LILRA6, PABPC1, and ARHGEF5) enriched in both Mexican T2DM and healthy groups.

MODY behaves as a genetically heterogeneous disease in the Mexican population. Although MODY 1-14 variants are frequent in Mexican patients, T2DM and healthy controls present similar frequency rates in most cases. MODY could behave as a polygenic disease in some patients and other genes may be involved in MODY Latino populations.

Introduction

Maturity-onset diabetes of the young (MODY) comprises a clinically heterogeneous group of monogenic forms of diabetes which present autosomal dominant inheritance in most cases, early onset in life, and absence of pancreatic beta-cell autoimmunity [1]. Up to 14 types of MODY have been described, related to genes that play key roles in pancreatic beta-cell differentiation, insulin secretion, and glucose metabolism [2]. The most frequently described genes encompass the hepatocyte nuclear factor 1α (HNF1A), hepatocyte nuclear factor 4α (HNF4A), and glucokinase (GCK) genes. Mutations in other genes such as PDX1, HNF1B, NEUROD1, KLF11, CEL, PAX4, INS, BLK, ABCC8, KCNJ11, and APPL1 have been described but are rather infrequent [3–5].

Despite MODY accounts for 1-5% of all diabetes cases, it is estimated that only 3% of the total MODY patients are correctly diagnosed, while the rest are mistakenly classified as type 1 (T1DM) or type 2 diabetes mellitus (T2DM) in 36% and 51% of cases, respectively [6,7]. Misdiagnosis of MODY remains widespread, as physicians face several challenges such as overlapping clinical phenotypes between MODY and other types of diabetes [8]. Establishment of an accurate diagnosis is a fundamental and frequently neglected aspect in diabetes care, as a tailored management can be initiated when correctly diagnosing MODY [8]. MODY subtypes exhibit distinct rates of microvascular complications and best respond to a specific management, such as sulfonylureas (SUR) in the case of MODY 1 and 3, whereas MODY 2 does not require pharmacologic interventions in many cases [8]. Moreover, appropriate diagnosis of MODY allows physicians to perform risk assessment in family members [9].

In addition to the clinical challenge imposed by overlapping phenotypes, a recent meta-analysis by Rafique et al. demonstrated remarkable variability within genetic variants in MODY patients across populations and pointed to the need of whole exome sequencing (WES) studies to identify new genes in non-caucasian populations with MODY [10]. It is of utmost importance to consider that most of the available literature and clinical diagnostic tools for MODY are based in European cohorts. Authors as Al-Kandari, et al. have reported that up to 77% of highly selected Middle-eastern patients with MODY suspect do not harbor variants of significance of known-MODY genes [11]. The registered proportion of MODY patients without a genetic diagnosis in Brazil ascends up to 73.9%, while in India, low genetic confirmation rates (6.6%) in patients with clinical diagnosis of MODY have been reported as well [12–15].

Regarding genetics of diabetes, research initiatives such as ProDiGY (Progress in Diabetes Genetics in the Youth), GUARDIAN (Genetics Underlying Diabetes in Hispanics) and the SIGMA Consortium (Studied from the Slim Initiative for Genomic Medicine), have evaluated genetic variants through genome wide-association studies and have characterized that some variants in SLC16A11, HNF1A, CDKAL1, MTNR1B and TCF7L2 increase the risk of T2DM in the Latino population [16–18]. In Mexico, despite the high prevalence of diabetes (18.3%) associated with the even higher prevalence of overweight (38.3%) and obesity (36.9%), few studies have addressed the genetic factors related with MODY and its prevalence remains unknown [19].

The aim of this study was to analyze and characterize the genetic variants present in Mexican patients with MODY through Whole Exome Sequencing (WES). We compare its analysis with a cohort of patients recently diagnosed (< 10 years) with T2DM and with young healthy participants. To the best of our knowledge this is the first study to characterize MODY and T2DM genetic variants through WES in the Mexican population and propose novel genes involved in this disease.

Methods

We enrolled a total of 51 participants divided in three groups (MODY, T2DM and healthy controls), each having 17 subjects. All MODY and T2DM patients were treated and followed at the Endocrinology Service of the Hospital de Especialidades, Centro Médico Nacional, Siglo XXI of the Instituto Mexicano del Seguro Social, a mexican tertiary hospital and reference center located in Mexico City.

All participating subjects signed an informed consent. This study was reviewed and approved by the institutional review board and ethics review board of the Hospital de Especialidades, Centro Médico Nacional, Siglo XXI of the Instituto Mexicano del Seguro Social (R-2023-3601-003 and R-2023-3601-212). The study was conducted in accordance with the national clinical research laws and the Helsinki declaration.

Inclusion criteria for MODY group comprised adult (≥18 years) subjects, with a calculated Exeter score equal or greater than 36%, with low (<1 U/Kg/day) or null insulin requirements, preserved beta-cell function (measured through serum C-peptide levels >1 ng/mL) and lack of anti-GAD65 and IAA autoantibodies, with regular outpatient follow-up, and who consent to participate. T2DM group inclusion criteria comprehended adult (≥18 years) patients with T2DM diagnosed with less than 10 years of evolution, with any type of glycemic treatment (insulin ± oral antidiabetic drugs) and any glycated hemoglobin (HbA1c). Inclusion criteria for healthy controls comprised adult (≥18 years) subjects, without any parental history of diabetes, with no metabolic diseases such as hypertension, diabetes or dyslipidemia.

From each patient, we collected data of clinical, biochemical, and anthropometric variables through physical and electronic medical records. We then calculated the Exeter score (available online at: https://www.diabetesgenes.org/exeter-diabetes-app/ModyCalculator) for all MODY cases and T2DM cases diagnosed under 35 years of age, and conducted statistical analyses using SPSS 24.0 (IBM, New York, USA) in order to apply Chi-square, T-Student test, or one-way ANOVA when applicable to compare the group’s baseline characteristics, as shown in Table 1. The level of significance was considered at a p-value <0.05.

View this table:
Table 1. Sociodemographic and clinical data of included participants

In order to carry genetic testing, we extracted peripheral blood from all subjects and extracted leukocyte DNA with Qiagen kit protocol. We carried out DNA purification using the DNAeasy (Qiagen Inc, CA, USA) blood and tissue kit. Leukocytes were lysed using proteinase K and the cell lysate was subsequently transferred to the DNAeasy columns. Once the DNA was captured in the columns, washes were carried out with the kit’s specific buffers to subsequently perform the elution of the DNA with molecular biology grade water. The high molecular weight DNA was evaluated to find the highest quality and purity using the NanoDrop2000 and the TapeStation (Agilent Technologies, CA, USA).

Whole Exome Sequencing (WES)

The genomic DNA (gDNA) was shipped to the Genomics Core Lab of the Tecnológico de Monterrey for exome sequencing. gDNA was quantified using Qubit dsDNA BR Assay Kit (Invitrogen, Carlsbad, CA, USA). Quality was determined spectrophotometrically using a Nanodrop One spectrophotometer (Thermo Fisher Scientific, Waltham MA, USA). WES libraries were prepared using Illumina DNA Prep with Exome 1.0 Enrichment (Illumina, San Diego CA, United States). All libraries were quantified with the Qubit dsDNA BR Assay Kit (Invitrogen, Carlsbad, CA, USA), library size was analyzed in S2 Standard DNA Cartridge for Sep 400 (BiOptic, New Taipei City, Taiwan), and sequencing was performed in a NovaSeq 6000 (Illumina, San Diego CA, United States) in a 150 bp paired-end configuration.

Computational Analysis WES

Preprocessed sequences were aligned to the human reference sequence (hg38) using the Illumina-Dragen Enrichment pipeline (llumina, San Diego CA, United States). This pipeline was set to produce copy number variants (--enable-cnv true). The BAM files resulting from the enrichment were removed from PCR duplicates using Picard Tools (http://broadinstitute.github.io/picard). Each BAM file was used to obtain the somatic variants using the GATK pipeline, and variants where annotated using ANNOVAR according to the following databases: Clinvar, gnomAD, refGene, cytoBand, exac03, avsnp147, dbnsfp30a. The VCF files were then transformed and annotated using the vcf2maf tool and VEP [20] 112 release database of ENSEMBL, IMPACT annotation was used to filter variants with “high” value. In addition, the Maftools package version 2.21.1 [21] in R language version 4.4.1 was used to analyze and visualize the landscape of critical variants. The groups were constructed using read.maf and merge_maf functions, to compare groups mafCompare function was used with a Fisher test on a 2×2 contingency table. Maftools visualization tools were used to generate the graphs.

Variant analysis of MODY-known and T2DM genes

For each included subject, we filtered all MODY 1-14 and T2DM genetic variants in order to evaluate the frequency at which every variant was detected in every patient and groups. We tracked an additional set of genes with previous reports of involvement in MODY such as RFX6, WFS1, NKX6-1, AKT2, NKX2-2, PCBD1, MTOR, TBC1D4, CACNA1E, and MNX1. Group frequencies per variant were compared across MODY versus T2DM, MODY versus healthy subjects and through all groups, using Chi-square calculation with SPSS 24.0 (IBM, New York, USA). The clinical impact of each genetic variant was categorized according to the ClinSig, SIFT, PolyPhen-2 (HUMVAR), and ClinVar databases. In the case of ClinVar dataset (https://www.ncbi.nlm.nih.gov/clinvar/) we reported the clinical impact of each variant only for MODY or monogenic diabetes. When a variant lacked a clinical impact report in monogenic diabetes through ClinVar, we reported the variant as unknown (Table 2).

View this table:
Table 2. Frequency of genetic variants of MODY and Type 2 Diabetes Mellitus

We carried genetic analysis upon individualized cases to explore the association of concomitant variants in single MODY patients and grouped all the pathogenic, probably and possibly damaging, deleterious, and variants with conflicting interpretations of pathogenicity (CIP) found per MODY patient in association with their current treatment and calculated Exeter score, as shown in Table 3. We further constructed a clustered heatmap and created a Principal Component Analysis (PCA) plot on ClustVis, an online web-tool using R package (version 0.7.7) [https://biit.cs.ut.ee/clustvis/] to present all detected variants across patients and groups.

View this table:
Table 3. Frequency of genetic variants among other genes associated with MODY (RFX6, WFS1, NKX6-1, AKT2, NKX2-2, PCBD1, MTOR, TBC1D4, CACNA1E, MNX1)

Results

A total of 51 patients were included in our study across 3 groups (MODY, T2DM, and healthy controls) each comprising 17 subjects. The mean age at evaluation of MODY patients was 21.2 ± 5.7 years, 43.5 ± 10.1 years in T2DM patients, and 25.5 ± 3.4 years in healthy controls. Mean age at diabetes diagnosis was significantly lower in the MODY group, being 21.2 years, compared to 43.5 years in the T2DM group (p<0.001). No significant differences were found regarding gender among groups (p=0.059). Parental history of diabetes was present in 88% of MODY group patients, while was present in 53% of T2DM subjects (p=0.023).

MODY and T2DM patients presented similar mean HbA1c levels (7.1 and 7.0%, respectively) as 47 and 53% of patients reached treatment goals, respectively. The T2DM group presented the highest frequency of overweight and obesity, with a mean BMI of 37.3 ± 10.4 kg/m2 (p <0.001) in contrast with a mean BMI of 25.1 ± 4.7 kg/m2 and 24.2 ± 3.0 kg/m2, in MODY and healthy groups, respectively. Similarly, mean waist circumference was greater in T2DM when compared to other groups (p <0.001). Upon evaluation of patient comorbidities, the T2DM group exhibited the highest frequency of systemic hypertension being 76% versus 5.8% in the MODY group (p<0.001). Conversely, dyslipidemia was more prevalent among MODY patients, with a frequency of 76% versus 27% (p <0.001). The mean Exeter score in MODY patients was 63.5 ± 14.3 (ranging from 35.8 to 75.5%), while the mean Exeter was 4.6% in T2DM when possible to calculate.

Regarding patient management, 94% of MODY patients underwent pharmacologic treatment for diabetes, as one MODY patient was effectively treated with lifestyle modifications. Among MODY patients, 58% were treated with metformin, 41% with insulin, 35% with SUR, and 17.5% with DPP-4 inhibitors, GLP-1 agonists, and SGLT2 inhibitors. Antidiabetic treatments did not differ among groups, except for SUR agents (p=0.033) as only 5.9% of T2DM patients received SUR treatment, as shown in Table 1.

Upon evaluation of genetic variants of MODY 1-14 genes through WES across all patients, we found 92 distinct exonic genetic variants in the MODY 1-14 genes. We did not detect any variants in INS (previously MODY 10). ABCC8, CEL, BLK and HNF1A presented the highest burden of variants across all patients. When comparing the MODY group with T2DM and healthy controls, we found statistically significant differences in variant frequencies in 5.3% of total variants, as shown in Table 2.

Five genetic variants displayed statistically significant different frequencies among the three groups. Firstly, c.C1226T:p.T409I and c.C2064G:p.G688G in the CEL gene were found in 58.9% and 17.6% of MODY cases versus 0% in other groups. Variant c.C1683T:p.H561H in ABCC8 was found in 70.6% of MODY cases, 23.5% of T2DM, and 64.7% of healthy subjects, while variants c.G864C:p.G288G and c.G1545A:p.T515T in HNF1A presented an increased frequency in T2DM and healthy controls over MODY patients. When considering statistical significant differences across MODY and healthy controls exclusively, the c.C341T:p.T114I variant in HNF4A was detected in 23.5% of MODY cases versus 0% of healthy controls (Table 2).

Upon clinical impact consideration based on predicting tools, among the 92 variants found, 3 were pathogenic and 4 presented a conflicting interpretation of pathogenicity (CIP) according to ClinSig; 17 were deleterious according to the SIFT score; 7 were probably damaging (D) and 8 possibly damaging (P) by PolyPhen-2 score; 3 presented a CIP, 2 were likely pathogenic (LP), 2 pathogenic and 5 were variants of uncertain significance (VUS), as shown in Table 2. CEL gene (MODY 8) presented the highest burden of pathogenic/damaging variants (7 in total), followed by HNF1A and BLK (3 in total each).

We detected the variant c.C1226T:p.T409I in CEL gene (deleterious by SIFT and probably damaging by PolyPhen) in 58.9% (10/17) of MODY patients, while in 0% of T2DM and healthy subjects, being the only pathogenic variant in MODY cases that reached statistical significance (p<0.001) across all groups.

Frequent pathogenic, possibly/probably damaging, deleterious, or CIP variants that were detected in Mexican MODY cases include c.A79C:p.I27L in HNF1A (CIP by ClinVar) and c.A2099G:p.E700G in APPL1 gene (deleterious by SIFT). The first was found in 64.7% of MODY patients while the second in 23.5% of MODY cases, however both presented similar frequencies in T2DM and healthy controls. Variants c.T2059G:p.S687A and c.G2065C:p.A689P in CEL were detected in 11.8% of MODY cases, while in 0% of T2DM and healthy controls, both being deleterious by SIFT and probably/possibly damaging by PolyPhen.

Other pathogenic, possibly/probably damaging, deleterious, or CIP variants present in 5.9% of MODY cases and 0% of T2DM and healthy subjects include c.1137delT:p.V380Sfs*4 in HNF1a (pathogenic according to ClinSig and ClinVar), c.T668C:p.M223T in GCK (deleterious by SIFT and likely pathogenic by ClinVar), NEUROD1 c.C590A:p.P197H (deleterious by SIFT), CEL c.G1801C:p.A601P, c.G41C:p.C14S, c.T1454C:p.I485T (all deleterious by SIFT and possibly/probably damaging by PolyPhen), CEL c.2032dupC:p.V681Rfs*6 (pathogenic by ClinSig), PAX4 c.G680A:p.R227Q (deleterious by SIFT and probably damaging by PolyPhen), ABCC8 (probably damaging by PolyPhen), and KCNJ11 c.C540G:p.L180L (CIP by ClinSig). Moreover, the variant c.A974C:p.K325T in BLK (deleterious by SIFT and possibly damaging by PolyPhen) was detected in a single MODY patient (5.9%) but was present in the same frequency in healthy controls (Table 2).

No pathogenic variants were detected in MODY cases for HNF4A, PDX1, HNF1B, NEUROD1, KLF11, and INS genes. Additionally, to the best of our knowledge this is the first study to report new variants in MODY patients such as KLF11 c.828_829insTCTGTC:p.V280_P281insSV, CEL c.C1164T:p.T388T, CEL c.C603T:p.F201F, and BLK c.C570T:p.S190S.

We further evaluated the frequency of genetic variants present in other genes associated with MODY (RFX6, WFS1, NKX6-1, AKT2, NKX2-2, PCBD1, MTOR, TBC1D4, CACNA1E, and MNX1), finding no statistically significant differences across groups (Table 3). For the WFS1 gene, a deleterious/probably damaging variant (c.G2596T:p.D866Y) was detected exclusively in a MODY case (patient #10), while we detected other deleterious/probably damaging variants that were present at similar frequency rates in T2DM and healthy controls. No variants of interest were found in NKX6-1, AKT2, NKX2-2, PCBD1, MTOR, CACNA1E, TBC1D4, and MNX1 genes (Table 3).

We further evaluated MODY patients individually and unveiled the presence of one or more possibly pathogenic, probably pathogenic, deleterious or variant with conflicting pathogenicity according to either Clinsig, SIFT, Polyphen, and ClinVar in 15 (88%) patients, and no pathogenic variants in 2 (12%) of them. Among the aforementioned 15 patients, a single variant was detected in three cases while the remaining twelve cases surprisingly presented two or more pathogenic variants, as up to five variants were detected in patients 1 and 6 (Table 4, Figure 1).

Figure 1.
Figure 1. Clustered heatmap of genetic variants for MODY and T2DM detected across groups

BMI=Body Mass Index; under treatment goals criteria was defined as an HbA1C equal or lower than 7.0%.

View this table:
Table 4. Pathogenic/possibly/probably pathogenic, deleterious, or CIP variants in MODY 1-14 genes per MODY patient

Regarding T2DM predisposing genes, a total of 38 variants (including HNF1A) were detected among all subjects. Two benign HNF1A variants yielded statistically significant differences across groups (c.G864C:p.G288G and c.G1545A:p.T515T), the first having a prevalence of 52.9, 82.4 and 88.2% among MODY, T2DM and healthy controls, while the second was present in 0% of patients with MODY, 17.6% of patients with T2DM, and 41.2% of healthy controls. No other significant differences were found in the rest of T2DM genes.

WES mutational analysis

Upon WES mutational analysis of all included subjects, the three groups exhibited similarities in the overall distribution of variants. However, each group presented specific genes with unique variants. MODY, T2DM, and healthy controls displayed an average range of 11,057 to 11,822 variants, with missense mutations being the most prevalent type. Among these, transitions (C>T and T>C) were the most common changes. The top mutated genes, including MUC4, MUC12, MUC16, and HLA-A, were shared across the groups. To identify differences in variant distribution between groups, we conducted a Fisher’s exact test on 2×2 contingency tables, revealing several genes with differential variants.

We describe several genes that exhibited significant differences among the groups. Considering a cutoff value of an adjusted p <0.01, we identified 53 genes when comparing MODY versus non-MODY cases, 30 genes in MODY versus T2DM, 30 genes in MODY versus healthy controls, and none in the comparison of T2DM versus healthy controls. When focusing exclusively on high-impact variants, we detected 21 significant genes in MODY versus non-MODY, 17 in MODY versus T2DM, 16 in MODY versus healthy, and none in T2DM versus healthy.

When comparing all exonic variants in the MODY versus the non-MODY group (T2DM + healthy controls), ABC7−42389800N19.1, ASAH2, OR2A42, and RIMBP3C harbored variants exclusive to the non-MODY group, while KCNJ12 and OR2A1 exhibited variants exclusively in MODY, as shown in Figure 2,3 and Table 5. Thus, KCNJ12 and OR2A1 presented multihit and missense variants in 100% of MODY cases, while no healthy or T2DM patients harbored such variants. When comparing MODY to T2DM, the same set of exclusive genes was observed. However, in the MODY versus healthy comparison, CLEC18B showed variants exclusively present in MODY, while only present in 12% of T2DM patients. Notably, no significant variants were detected between the T2DM and healthy groups.

Figure 2.
Figure 2. Frequency of overall genetic variants in MODY and T2DM patients
Figure 3.
Figure 3. Frequency of overall genetic variants in MODY and healthy subjects
View this table:
Table 5. Genes with statistically significant differences across MODY versus T2DM and healthy groups

Other genes presented statistically significant differences across MODY and non-MODY groups, without being exclusive to any. Genes such as RIMBP3, TRIM49C, CLEC18B, OR2T5, PEX5, AQP12B, OR51A4, SYT15, TRIM64, GSTT2B, SUSD2, TPTE, and ZNF814 were enriched in MODY patients, while NBPF6, PGA3, GOLGA8N, PABPC1, PABPC3, CNTNAP3B, POTEM, and SPIN2A in non-MODY cases (Figure 2,3 and Table 5).

We further identified high-impact variants that distinguished between groups. In the MODY versus non-MODY comparison, splice-site variants in ABC7−42389800N19.1 and multiple high-impact variants in MUC6 were exclusive to the non-MODY group, while MAP2K3 harbored nonsense mutations exclusively in MODY (Figure 4,5,6 and Table 5). In the MODY versus healthy comparison, OR8U1 exhibited multiple high-impact variants, which were exclusive to the healthy group. No significant variants were identified between T2DM and healthy groups. Finally, we found significant differences in the frequency of high impact genetic variants when comparing the MODY group versus the T2DM and healthy groups in additional genes to MAP2K3 such as PEX5, KMT2C, and ZNF717 (all with a p-value <0.01 in both comparisons), while TPTE, DHRS4L2, and IL32 genes presented high impact variants in the MODY patients with significant differences (p<0.05) when compared to the T2DM group but not versus healthy controls (Figure 4,5,6 and Table 5). Specifically, the detected variants in MAP2K3 include c.281G>T (p.Arg94Leu), c.286C>T (p.Arg96Trp), c.304C>T (p.Gln102Ter) (all three found in 100% of MODY patients, while 0% of non-MODY), and variant c.118C>A (p.Pro40Thr), found exclusively in 94% of MODY cases. Regarding PEX5 gene, the splicing variant (c.210+77_210+121delCAGCCTCTGAGGCAGTGAGTGTTCTTGAGGTGGAAAGCCCAGG TG) was identified in 94% of MODY cases exclusively. c.2447dupA (p.Tyr816Ter) variant in KMT2C was found in 76% of MODY cases exclusively. In the IL32 gene, the frameshift variant c.652dupG (p.Asp218GlyfsTer12) and the missense variant c.653A>G (p.Asp218Gly) were found in 47% of MODY cases.

Figure 4.
Figure 4. Frequency of high impact genetic variants in MODY and T2DM patients
Figure 5.
Figure 5. Frequency of high impact genetic variants in MODY and healthy subjects
Figure 6.
Figure 6. Lollipop diagrams of MODY enriched genes in the Mexican population contrasting variant frequency versus non-MODY group

Upper row MAP2K3 (left), PEX5 (right); second row ZNF717 (left), KMT2C (right); third row KCNJ12 (left), OR2A1 (right); lower row CLEC18B (left), OR2T5 (right).

Conversely, genes that frequently presented high impact variants in T2DM and healthy controls while were rather infrequent among MODY patients include the previously mentioned ABC7 and MUC6, PLIN4, OR8U1, NBPF11, PABPC3, RBMX, LILRA6, PABPC1, and ARHGEF5, all of which presented significant differences in both groups when compared to MODY at a p<0.01 (Table 5).

Discussion

We characterized the genomic landscape of Mexican MODY patients by describing the variant frequency of MODY and T2DM predisposing genes across three cohorts of Mexican healthy, T2DM, and MODY subjects and proposed a set of novel candidate genes that displayed significant differences across groups in a Latino population.

Our findings indicate that although several MODY 1-14 gene variants are present in Mexican MODY cases, they do not differ significantly from T2DM and healthy Mexican individuals in most cases, as only 5% of MODY-known variants displayed significant differences among non-MODY subjects. The only pathogenic/damaging genetic variant that presented statistical significant differences with an increased frequency in MODY patients was c.C1226T:p.T409I in CEL gene (deleterious by SIFT and probably damaging by PolyPhen), detected in 58.9% (10/17) of MODY patients, while was present in 0% of T2DM and healthy subjects. Other benign variants that presented an increased frequency in MODY subjects when compared to the other two groups include c.C2064G:p.G688G in CEL gene, and c.C1683T:p.H561H in the ABCC8 gene, which was significatively more frequent in MODY when comparing with T2DM patients but not in healthy subjects. In the HNF4A gene, the variant c.C341T:p.T114I (likely benign) was significatively more frequent in MODY than in healthy subjects, but not T2DM.

Other possibly/probably pathogenic, deleterious, pathogenic or CIP variants that presented non-statistically significant differences between groups that were detected in MODY cases include HNF1A c.A79C:p.I27L, which presented a similar frequency among the three groups, ranging from 58-64%; APPL1 c.A2099G:p.E700G, detected in 23.5% of MODY patients; c.T2059G:p.S687A, and c.G2065C:p.A689P in CEL gene, found in 11.7% of MODY cases and absent in all T2DM and healthy controls, and other variants found in single MODY patients and no controls such as GCK c.T668C:p.M223T; HNF1A c.1137delT:p.V380Sfs*4; CEL c.G1801C:p.A601P, c.G41C:p.C14S, c.T1454C:p.I485T, c.c.2032dupC:p.V681Rfs*6; PAX 4 c.G680A:p.R227Q.

Variants in T2DM-predisposing genes that exhibited significant differences favoring an increased frequency in T2DM and healthy groups include: HNF1A c.G864C:p.G288G and c.G1545A:p.T515T (both benign for MODY and VUS for T2DM according to ClinVar), and CEL c.C1710T:p.P570P (likely benign through ClinSig).

When analyzing MODY cases individually, 12% of MODY patients did not harbor any variant of risk for classical MODY 1-14 genes, 18% of cases presented a single possibly/probably pathogenic, deleterious, pathogenic or CIP variant, and 70% of patients presented two or more concomitant genetic variants with the aforementioned clinical impact. However, if we do not consider CIP variants, the frequency of MODY patients without a detected MODY variant rises up to 24%.

Our findings indicate that contrary to the existing literature MODY does not always behave as a monogenic disease in a Latino population, as concomitant pathogenic, possibly/probably damaging, deleterious or CIP variants were detected in single cases. Thus, MODY is a polygenic disease in several cases, which leads to a paradigm shift in the understanding of this disease in non-caucasian populations.

The association of 1) no MODY-known pathogenic, possibly/probably damaging, deleterious or CIP variants in 12-24% of our MODY patients upon individual analysis, 2) finding only one SIFT-deleterious and PolyPhen-probably damaging variant that yielded statistically significant differences among groups, and 3) the fact that MODY 1-14 genes description is based on caucasian populations, lead us to investigate the presence of other genetic variants that could explain MODY genetic landscape in our population. This knowledge gap is supported by several authors who have pointed to the existence of other genes involved in early onset of diabetes in non-caucasian populations, and the need of WES studies to elucidate new genes involved in glycaemic regulation [10,11,22,23].

Additional efforts conducted worldwide to better characterize MODY have pointed out other genes and variants linked to this disease. Patel et al. reported the involvement of RFX6 variants in a Finnish cohort of MODY cases, which has also been documented in case reports [24,25]. We intentionally searched all RFX6 variants and found a non-statistically significant increased frequency of several variants among MODY cases, being all benign or likely benign through ClinSig database. Regarding the enrichment of p.His293Leu variant reported by Patel et al within Finnish MODY cases, we did not detect the aforementioned variant in any of our patients or controls [24]. Additionally, other authors such as Mohan et al. evaluated variants of known-MODY and other genes such as WFS1, NKX6-1, and AKT2 in South Indian patients with MODY (Table 3) [26]. Moreover, Jakiel et al. proposed a set of candidate genes including MTOR, TBC1D4, CACNA1E, and MNX1 in Polish MODY patients without a genetic diagnosis, and Simaite et al. described the causal role of PCBD1 mutations in early-onset non autoimmune diabetes [27,28]. We intentionally searched for genetic variants in all of the aforementioned genes and did not find statistically significant different frequencies across groups in our studied population (Table 3).

In the context of a highly heterogeneous genetic disease where the current evidence has been predominantly generated upon caucasian populations, we propose a novel set of candidate genes in a Latino MODY population. Considering the cutoff value of an adjusted p <0.01, we propose a set of 15 candidate genes (KCNJ2, OR2A1, RIMBP3, TRIM49C, CLEC18B, OR2T5, PEX5, AQP12B, OR51A4, SYT15, TRIM64, GSTT2B, SUSD2, TPTE, ZNF814) which are significantly enriched in Mexican MODY patients and not in T2DM and healthy subjects belonging to the same population, and 12 genes significantly enriched in Mexican T2DM and healthy groups, while not in MODY cases (ABC7, ASAH2, OR2A42, RIMBP3C, NBPF6, PGA3, GOLGA8N, PABPC1, PABPC3, CNTNAP3B, POTEM, SPIN2A).

Upon analysis of high impact variants exclusively and considering a cutoff value of an adjusted p<0.01, we propose a set of 4 genes (MAP2K3, PEX5, KMT2C, and ZNF717) enriched in the MODY population when compared to both T2DM and healthy subjects and 10 genes (ABC7, MUC6, PLIN4, OR8U1, NBPF11, PABPC3, RBMX, LILRA6, PABPC1, and ARHGEF5) enriched in both Mexican T2DM and healthy groups.

Additionally, TPTE, DHRS4L2, and IL32 genes presented high impact variants in the MODY patients with statistically significant differences when compared to the T2DM group. Several of the proposed genes have implications on glucose metabolism and beta-cell function. In-depth understanding and analysis of the possible association of each candidate gene represents a key aspect in which our findings may contribute to the understanding of MODY pathophysiology.

The MAP2K3 gene encodes for a protein that belongs to a MAP kinase kinase family, which mediates MAP signaling kinase pathway through phosphorylation of MAP14/p38-MAPK [29]. In glycemic regulation, MAP2K3 activity is enhanced by insulin, being necessary for the expression of glucose transporters [30]. Fujishiro et al. described the role of p38-MAPK and MAPK6 glucose transport regulation, describing that p38-MAPK activation leads to downregulation of insulin-induced glucose uptake via GLUT4 [30], which could also explain insulin resistance states in cellular stress conditions. Li et al also examined the effect of AMPK (AMP-activated protein kinase) in p38-MAPK activation, finding p38-MAPK involvement in glucose transport, while its inhibition reduced glucose uptake and GLUT 4 translocation [31]. Other authors have described altered p38-MAPK activity in skeletal muscle, adipose tissue among T2DM patients and in diabetic nephropathy [32,33].

Next, PEX5 gene plays a crucial role in peroxisomal protein import, as its product binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal [29]. PEX5 delivers folded proteins from the cytosol into peroxisomes, translocating them across the membrane and then returning to the cytosol [34]. Peroxisomes are ubiquitous organelles deeply involved in lipid metabolism, and beta-cell homeostasis. Baboota et al demonstrated in a murine model impaired insulin secretion, and glucose intolerance in Rip-Pex5 -/- mice due a decrease in the density of mature insulin granules, degenerative features of mitochondria and accumulation of vacuole-like structures, which have also been identified in beta-cells from patients with T2DM [35]. Peroxisome proliferator-activated receptor(PPAR) alpha agonists have also been demonstrated to confer protection to beta-cells against fatty acids such as palmitate [36]. Defects in PEX genes and peroxisome biogenesis impact multiple systems, as found in Zellweger spectrum disorders, characterized by lipid metabolism alterations, distinct craniofacial malformations, hepatomegaly, renal cysts, seizures, and profound hypotonia [37,38].

The KMT2C gene (lysine methyltransferase 2C) encodes for a protein with high histone methylation activity and involvement in transcriptional activation [29]. Lysine methylation plays a key role in glucose and lipid metabolism, as analysis of human insulin promoters have identified various CpG sites in upstream regions to the transcription start site of insulin and demethylation is considered to play a crucial role in beta-cell maturation and tissue-specific insulin gene expression [39,40]. Islets in T2DM patients present increased DNA methylation and decreased expression of several key genes, existing impaired insulin secretion [40]. Moreover, methylation regulates rate-limiting enzymes in several metabolic pathways, being altered methylation patterns frequently encountered in T2DM [41].

Another gene with high impact variants predominantly found in MODY with not fully understood implications in glucose metabolism is the ZNF717 gene. Zinc-finger proteins are involved in transcriptional regulation and play key roles in various cellular functions including cell proliferation, differentiation and apoptosis [29,42]. Several ZNF family genes are considered to have a key role in diabetes, such as GLIS3, which regulates insulin expression through binding to the INS promoter and regulation of beta-cell transcription factors, while GLIS3 mutations are considered a cause of neonatal diabetes [42]. Deficiency in other members of the Zinc finger protein family such as the ZFP251 have been discovered to induce glucose metabolism impairment through adipocyte hypertrophy in mice [43]. ZFP407 regulates insulin-stimulated glucose uptake in adipocytes via GLUT4, and is involved in PPAR gamma regulation, which induces GLUT4 expression and is the target of rosiglitazone [44].

We described enrichment in other genes such as DHRS4L2 (Dehydrogenase/Reductase 4 Like 2), which encodes for a member of the short chain dehydrogenase reductase family [29]. Regarding the IL32 gene, increased IL-32 plasma levels have been documented in Mexican subjects with overweight and obesity, while have been also associated with T2DM in a middle-eastern population [45,46]. TPTE gene (transmembrane phosphatase with tensin homology), plays a key role in signal transduction pathways in endocrine and spermatogenic functions in the testis [29]. The specific association and mechanisms of the above mentioned genes in glucose metabolism remain to be elucidated through further research.

The proposed genes also include KCNJ12, which similarly to KCNJ11 (MODY 13 causal gene) encodes for a Potassium Inwardly Rectifying Channel (Kir 2.2) [29]. It also contributes to the cardiac inwardly rectifying potassium current (IK1) that stabilizes resting membrane potential, and is responsible for shaping the initial depolarization and final repolarization of the action potential [47]. Mutations in this gene have been related with colorectal carcinoma, head and neck squamous cell carcinoma, esophageal squamous cell carcinoma and skin cancer, as well as with dilated cardiomyopathy [48]. In cancer oncogenesis, KCNJ12 acts as a target for miR-132-3p to modulate the AKT signaling pathway, also involved in the glucose metabolism by increasing GLUT-1 and GLUT-4 translocation [49].

Other proposed candidate genes are reported in literature for their role in metabolic disorders such as OR2A1 (Olfactory Receptor Family 2 Subfamily A Member 1), which was found differentially expressed in T2DM and obesity [50]. Moreover, Olfactory Receptors (OR) play key roles in glucose metabolism, as participates in gluconeogenesis in the liver and is expressed in pancreatic islets, regulating insulin secretion in an autocrine manner and involving in islet homeostasis [51,52]. TRIM64 large copy-number variation enrichment was reported by Wang et al. in patients with moderate to extreme obesity when compared to control subjects [53].

WASHC1 gene encodes for the Wiskott-Aldrich Syndrome complex subunit 1. WAS protein superfamilies are involved in endosomal receptor trafficking via Arp2/3 complex activation [54]. WASH is highly expressed in both human and murine pancreatic islets. Ding et al. demonstrated through a conditional knockout (cKO) in murine pancreatic beta-cells the presence of impaired glucose clearance and significantly lower insulin release in cKO mice. Another fundamental implication of WASH in glucose metabolism is the fact that GLUT2 protein levels decrease in the absence of WASH [54].

Aquaporins (AQP) are a family of membrane proteins that serve as transmembrane water channels [55]. AQP are directly involved in insulin resistance and T2DM, lipid metabolism, and oxidative stress regulation [55]. AQP7 expression has been demonstrated in pancreatic beta-cells and AQP7 knockout mice display increased insulin secretion, augmented intracellular triacylglycerol concentrations, and reduced beta-cell mass [56]. Additionally, AQP7 protein expression is increased in obese men with T2DM [56]. Further research is required to elucidate if AQP12A gene plays a role in glucose metabolism and insulin secretion.

The ABC7 gene belongs to the adenosine triphosphate-binding cassette (ABC) transporter superfamily, and encodes for a protein responsible for the transport across extra- and intra-cellular membranes [29, 57]. In glucose metabolism, the concentration of cholesterol in beta-cells is considered a determinant for islet dysfunction, being regulated by two ABC superfamily members [58]. ABCA1 deficiency in beta-cells resulted in impaired insulin secretion in murine models, while some variants are associated with increased risk of ischemic heart disease [59,60]. Nevertheless, ABCA1 genetic variants are not considered to increase T2DM risk in the general population [58]. Furthermore, ABCC8 (ATP-binding cassette transporter sub-family C member 8) encodes the sulfonylurea receptor 1 (SUR1), being its mutations associated with MODY type 12 [61,62]. SUR1 regulates the activity of the potassium channel in pancreatic beta-cells membrane. Activating SUR1 mutations cause decreased insulin secretion [62].

The MUC6 gene encodes for a member of the mucin protein family, which are high molecular weight glycoproteins produced by several epithelial tissues [29]. Pujar et al. reported MUC6 enrichment as a candidate biomarker for T1DM, being closely related to disease progression and occurrence of hypertension [63]. The MUC6 gene is physiologically expressed in pancreatic tissue, and has been related to pancreatic neoplasia [64]. Moreover, MUC6 has been linked to distinct types of diabetes and immune regulation, authors as Mousa et al. have pointed out the need to elucidate the association of MUC6 with diabetes [65].

To the best of our knowledge, this study represents the first effort to characterize the genomic landscape of Mexican MODY patients through WES and to propose a set of candidate genes involved in MODY diagnosis, which can serve as potential biomarkers to better diagnose monogenic diabetes in Latino populations. The strengths of our study include conducting WES as part of the methodology unlike other studies of MODY using panels with limited genes and the comparison of our findings in MODY patients with healthy controls and T2DM belonging to the same Latino population. Limitations of our study include the need for external validation of the novel candidate genes, lack of non-coding region analysis, and lack of genetic evaluation of MODY patient relatives.

Future perspectives on this line of research include performing external validation of the candidate genes, evaluation of the genomic landscape in Mexican pediatric MODY patients, genotype-phenotype association analysis among cases, and development of AI-assisted models to better predict and combine biomarkers for the diagnosis of MODY. The latter could help incorporate new tools into clinical practice in order to achieve a correct diagnosis of patients with MODY in the context of a Latino population.

Conclusion

MODY presents as a genetically heterogeneous disease in the Mexican population. Despite that MODY 1-14 genetic variants are frequent among Mexican MODY patients, T2DM and healthy controls present similar frequency rates in most of them. In many cases, we identified the presence of concomitant variants among Mexican MODY cases, indicating that MODY behaves as a polygenic disease in some patients. Moreover, we proposed a novel set of candidate genes that presented significant enrichment in Mexican MODY patients and could be associated with MODY pathogenesis and diagnosis in the context of Latino populations.

Data Availability

All data produced in the present study are available upon reasonable request to the authors

Conflicts of interest

The authors have no conflicts of interest to declare.

Footnotes

  • Unidad de Investigación Médica en Enfermedades Endocrinas, Hospital de Especialidades, Centro Médico Nacional Siglo XXI Instituto Mexicano del Seguro Social., Av. Cuauhtémoc 330, Col. Doctores, México D.F. 06720 Phone: +54401021

References

  1. 1.↵
    - Fajans SS, Bell GI, Polonsky KS. Molecular Mechanisms and Clinical Pathophysiology of Maturity-Onset Diabetes of the Young. N Engl J Med. 2001 Sep 27;345(13):971–80.
    OpenUrlCrossRefPubMedWeb of Science
  2. 2.↵
    Peixoto-Barbosa R, Reis AF, Giuffrida FMA. Update on clinical screening of maturity-onset diabetes of the young (MODY). Diabetol Metab Syndr. 2020 Dec;12(1):50.
    OpenUrlCrossRefPubMed
  3. 3.↵
    Thanabalasingham G, Owen KR. Diagnosis and management of maturity onset diabetes of the young (MODY). BMJ. 2011 Oct 19;343(oct19 3):d6044–d6044.
    OpenUrlFREE Full Text
  4. 4.
    Nkonge KM, Nkonge DK, Nkonge TN. The epidemiology, molecular pathogenesis, diagnosis, and treatment of maturity-onset diabetes of the young (MODY). Clin Diabetes Endocrinol. 2020 Dec;6(1):20.
    OpenUrl
  5. 5.↵
    Breidbart E, Deng L, Lanzano P, Fan X, Guo J, Leibel RL, et al. Frequency and characterization of mutations in genes in a large cohort of patients referred to MODY registry. Journal of Pediatric Endocrinology and Metabolism. 2021 May 26;34(5):633–8.
    OpenUrl
  6. 6.↵
    Kavvoura FK, Owen KR. Maturity onset diabetes of the young: clinical characteristics, diagnosis and management. Pediatr Endocrinol Rev. 2012 Jan;10(2):234–42.
    OpenUrlPubMed
  7. 7.↵
    Pihoker C, Gilliam LK, Ellard S, Dabelea D, Davis C, Dolan LM, et al. Prevalence, Characteristics and Clinical Diagnosis of Maturity Onset Diabetes of the Young Due to Mutations in HNF1A, HNF4A, and Glucokinase: Results From the SEARCH for Diabetes in Youth. The Journal of Clinical Endocrinology & Metabolism. 2013 Oct;98(10):4055–62.
    OpenUrl
  8. 8.↵
    Thanabalasingham G, Pal A, Selwood MP, Dudley C, Fisher K, Bingley PJ, et al. Systematic Assessment of Etiology in Adults With a Clinical Diagnosis of Young-Onset Type 2 Diabetes Is a Successful Strategy for Identifying Maturity-Onset Diabetes of the Young. Diabetes Care. 2012 Jun 1;35(6):1206–12.
    OpenUrlAbstract/FREE Full Text
  9. 9.↵
    Zhao J, Chen Y, Ma F, Shu H, Zheng L, Liu Y, et al. MODY Probability Calculator Is Suitable for MODY Screening in China: A Population-based Study. Journal of the Endocrine Society. 2024 Mar 12;8(5):bvae047.
    OpenUrl
  10. 10.↵
    Rafique I, Mir A, Saqib MAN, Naeem M, Marchand L, Polychronakos C. Causal variants in Maturity Onset Diabetes of the Young (MODY) – A systematic review. BMC Endocr Disord. 2021 Dec;21(1):223.
    OpenUrl
  11. 11.↵
    Al-Kandari H, Al-Abdulrazzaq D, Davidsson L, Nizam R, Jacob S, Melhem M, et al. Identification of Maturity-Onset-Diabetes of the Young (MODY) mutations in a country where diabetes is endemic. Sci Rep. 2021 Aug 9;11(1):16060.
    OpenUrl
  12. 12.↵
    Furuzawa GK, Giuffrida FMA, Oliveira CSV, Chacra AR, Dib SA, Reis AF. Low prevalence of MODY2 and MODY3 mutations in Brazilian individuals with clinical MODY phenotype. Diabetes Research and Clinical Practice. 2008 Sep;81(3):e12–4.
    OpenUrlPubMed
  13. 13.
    Maraschin JDF, Kannengiesser C, Murussi N, Campagnolo N, Canani LH, Gross JL, et al. HNF1α mutations are present in half of clinically defined MODY patients in South-Brazilian individuals. Arq Bras Endocrinol Metab. 2008 Nov;52(8):1326–31.
    OpenUrlPubMed
  14. 14.
    Giuffrida FMA, Moises RS, Weinert LS, Calliari LE, Manna TD, Dotto RP, et al. Maturity-onset diabetes of the young (MODY) in Brazil: Establishment of a national registry and appraisal of available genetic and clinical data. Diabetes Research and Clinical Practice. 2017 Jan;123:134–42.
    OpenUrl
  15. 15.↵
    Sampathkumar G, Valiyaparambil PP, Kumar H, Bhavani N, Nair V, Menon U, et al. Low genetic confirmation rate in South Indian subjects with a clinical diagnosis of maturity-onset diabetes of the young (MODY) who underwent targeted next-generation sequencing for 13 genes. J Endocrinol Invest. 2022 Mar;45(3):607–15.
    OpenUrl
  16. 16.↵
    Srinivasan S, Chen L, Todd J, Divers J, Gidding S, Chernausek S, et al. The First Genome-Wide Association Study for Type 2 Diabetes in Youth: The Progress in Diabetes Genetics in Youth (ProDiGY) Consortium. Diabetes. 2021 Apr 1;70(4):996–1005.
    OpenUrlAbstract/FREE Full Text
  17. 17.
    Palmer ND, Goodarzi MO, Langefeld CD, Wang N, Guo X, Taylor KD, et al. Genetic Variants Associated With Quantitative Glucose Homeostasis Traits Translate to Type 2 Diabetes in Mexican Americans: The GUARDIAN (Genetics Underlying Diabetes in Hispanics) Consortium. Diabetes. 2015 May 1;64(5):1853–66.
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    Estrada K, Aukrust I, Bjørkhaug L, Burtt NP, Mercader JM, García-Ortiz H, et al. Association of a Low-Frequency Variant in HNF1A With Type 2 Diabetes in a Latino Population. JAMA. 2014 Jun 11;311(22):2305.
    OpenUrlCrossRefPubMed
  19. 19.↵
    Basto-Abreu A, López-Olmedo N, Rojas-Martínez R, Aguilar-Salinas CA, Moreno-Banda GL, Carnalla M, et al. Prevalencia de prediabetes y diabetes en México: Ensanut 2022. Salud Publica Mex. 2023 Jun 13;65:s163–8.
    OpenUrl
  20. 20.↵
    McLaren W, Gil L, Hunt SE, Riat HS, Ritchie GRS, Thormann A, et al. The Ensembl Variant Effect Predictor. Genome Biol. 2016 Dec;17(1):122.
    OpenUrlCrossRefPubMed
  21. 21.↵
    Mayakonda A, Lin DC, Assenov Y, Plass C, Koeffler HP. Maftools: efficient and comprehensive analysis of somatic variants in cancer. Genome Res. 2018 Nov;28(11):1747–56.
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    Yalçın Çapan Ö, Aydın N, Yılmaz T, Berber E. Whole exome sequencing reveals novel candidate gene variants for MODY. Clinica Chimica Acta. 2020 Nov;510:97–104.
    OpenUrl
  23. 23.↵
    Zhong L, Zhao Z, Hu Q, Li Y, Zhao W, Li C, et al. Identification of Maturity-Onset Diabetes of the Young Caused by Mutation in FOXM1 via Whole-Exome Sequencing in Northern China. Front Endocrinol. 2021 Feb 9;11:534362.
  24. 24.↵
    Patel KA, Kettunen J, Laakso M, Stančáková A, Laver TW, Colclough K, et al. Heterozygous RFX6 protein truncating variants are associated with MODY with reduced penetrance. Nat Commun. 2017 Oct 12;8(1):888.
    OpenUrl
  25. 25.↵
    Imaki S, Iizuka K, Horikawa Y, Yasuda M, Kubota S, Kato T, et al. A novel RFX6 heterozygous mutation (p.R652X) in maturity-onset diabetes mellitus: A case report. J of Diabetes Invest. 2021 Oct;12(10):1914–8.
    OpenUrl
  26. 26.↵
    Mohan V, Radha V, Nguyen TT, Stawiski EW, Pahuja KB, Goldstein LD, et al. Comprehensive genomic analysis identifies pathogenic variants in maturity-onset diabetes of the young (MODY) patients in South India. BMC Med Genet. 2018 Dec;19(1):22.
    OpenUrlCrossRef
  27. 27.↵
    Jakiel P, Gadzalska K, Juścińska E, Gorządek M, Płoszaj T, Skoczylas S, et al. Identification of rare variants in candidate genes associated with monogenic diabetes in polish mody-x patients. J Diabetes Metab Disord. 2023 Oct 13;23(1):545–54.
    OpenUrl
  28. 28.↵
    Simaite D, Kofent J, Gong M, Rüschendorf F, Jia S, Arn P, et al. Recessive Mutations in PCBD1 Cause a New Type of Early-Onset Diabetes. Diabetes. 2014 Oct 1;63(10):3557–64.
    OpenUrlAbstract/FREE Full Text
  29. 29.↵
    Sayers EW, Bolton EE, Brister JR, Canese K, Chan J, Comeau DC, et al. Database resources of the national center for biotechnology information. Nucleic Acids Research. 2022 Jan 7;50(D1):D20–6.
    OpenUrlCrossRefPubMed
  30. 30.↵
    Fujishiro M, Gotoh Y, Katagiri H, Sakoda H, Ogihara T, Anai M, et al. MKK6/3 and p38 MAPK Pathway Activation Is Not Necessary for Insulin-induced Glucose Uptake but Regulates Glucose Transporter Expression. Journal of Biological Chemistry. 2001 Jan;276(23):19800–6.
    OpenUrlAbstract/FREE Full Text
  31. 31.↵
    Li J, Miller EJ, Ninomiya-Tsuji J, Russell RR, Young LH. AMP-Activated Protein Kinase Activates p38 Mitogen-Activated Protein Kinase by Increasing Recruitment of p38 MAPK to TAB1 in the Ischemic Heart. Circulation Research. 2005 Oct 28;97(9):872–9.
    OpenUrlAbstract/FREE Full Text
  32. 32.↵
    Adhikary L, Chow F, Nikolic-Paterson DJ, Stambe C, Dowling J, Atkins RC, et al. Abnormal p38 mitogen-activated protein kinase signalling in human and experimental diabetic nephropathy. Diabetologia. 2004 Jul;47(7):1210–22.
    OpenUrlCrossRefPubMedWeb of Science
  33. 33.↵
    Koistinen HA, Chibalin AV, Zierath JR. Aberrant p38 mitogen-activated protein kinase signalling in skeletal muscle from Type 2 diabetic patients. Diabetologia. 2003 Oct 1;46(10):1324–8.
    OpenUrlCrossRefPubMedWeb of Science
  34. 34.↵
    Skowyra ML, Rapoport TA. PEX5 translocation into and out of peroxisomes drives matrix protein import. Molecular Cell. 2022 Sep;82(17):3209–3225.e7.
    OpenUrl
  35. 35.↵
    Baboota RK, Shinde AB, Lemaire K, Fransen M, Vinckier S, Van Veldhoven PP, et al. Functional peroxisomes are required for β-cell integrity in mice. Molecular Metabolism. 2019 Apr;22:71–83.
    OpenUrl
  36. 36.↵
    Hellemans K, Kerckhofs K, Hannaert J, Martens G, Van Veldhoven P, Pipeleers D. Peroxisome proliferator-activated receptor α–retinoid X receptor agonists induce beta-cell protection against palmitate toxicity. The FEBS Journal. 2007 Dec;274(23):6094–105.
    OpenUrlCrossRefPubMed
  37. 37.↵
    Wangler MF, Hubert L, Donti TR, Ventura MJ, Miller MJ, Braverman N, et al. A metabolomic map of Zellweger spectrum disorders reveals novel disease biomarkers. Genetics in Medicine. 2018 Oct;20(10):1274–83.
    OpenUrlCrossRef
  38. 38.↵
    Aubourg P, Robain O, Rocchiccioli F, Dancea S, Scotto J. The cerebro-hepato-renal (Zellweger) syndrome: Lamellar lipid profiles in adrenocortical, hepatic mesenchymal, astrocyte cells and increased levels of very long chain fatty acids and phytanic acid in the plasma. Journal of the Neurological Sciences. 1985 May;69(1–2):9–25.
    OpenUrlCrossRefPubMedWeb of Science
  39. 39.↵
    1. Maedler K
    Kuroda A, Rauch TA, Todorov I, Ku HT, Al-Abdullah IH, Kandeel F, et al. Insulin Gene Expression Is Regulated by DNA Methylation. Maedler K, editor. PLoS ONE. 2009 Sep 9;4(9):e6953.
    OpenUrlCrossRefPubMed
  40. 40.↵
    Ling C, Rönn T. Epigenetics in Human Obesity and Type 2 Diabetes. Cell Metabolism. 2019 May;29(5):1028–44.
    OpenUrl
  41. 41.↵
    Kowluru RA, Mohammad G. Epigenetic modifications in diabetes. Metabolism. 2022 Jan;126:154920.
  42. 42.↵
    Cassandri M, Smirnov A, Novelli F, Pitolli C, Agostini M, Malewicz M, et al. Zinc-finger proteins in health and disease. Cell Death Discov. 2017 Nov 13;3(1):17071.
    OpenUrl
  43. 43.↵
    Kim E, Ham SA, Hwang JS, Won JP, Lee HG, Hur J, et al. Zinc finger protein 251 deficiency impairs glucose metabolism by inducing adipocyte hypertrophy. Molecular and Cellular Endocrinology. 2023 Feb;562:111838.
  44. 44.↵
    Buchner DA, Charrier A, Srinivasan E, Wang L, Paulsen MT, Ljungman M, et al. Zinc Finger Protein 407 (ZFP407) Regulates Insulin-stimulated Glucose Uptake and Glucose Transporter 4 (Glut4) mRNA. Journal of Biological Chemistry. 2015 Mar;290(10):6376–86.
    OpenUrlAbstract/FREE Full Text
  45. 45.↵
    Martínez Pérez LA, Becerra-Ruiz JS, García-Aviña JE, González–Sánchez GD, Martínez–Esquivias F, Vázquez-Jiménez SI, et al. Relation of serum IL-32 levels and gene polymorphism rs45499297 with obesity in Mexican patients: a laboratory and in silico analysis. Nutr Hosp [Internet]. 2022 [cited 2024 Oct 1]; Available from: https://www.nutricionhospitalaria.org/articles/03804/show
  46. 46.↵
    Fadaei R, Bagheri N, Heidarian E, Nouri A, Hesari Z, Moradi N, et al. Serum levels of IL-32 in patients with type 2 diabetes mellitus and its relationship with TNF-α and IL-6. Cytokine. 2020 Jan;125:154832.
  47. 47.↵
    Dhamoon AS, Jalife J. The inward rectifier current (IK1) controls cardiac excitability and is involved in arrhythmogenesis. Heart Rhythm. 2005 Mar;2(3):316–24.
    OpenUrlCrossRefPubMedWeb of Science
  48. 48.↵
    Chen K, Hu YY, Wang LL, Xia Y, Jiang Q, Sun L, et al. Whole-Genome Sequencing Identified KCNJ12 and SLC25A5 Mutations in Port-Wine Stains. Front Med. 2022 Jul 20;9:905902.
  49. 49.↵
    Cong LN, Chen H, Li Y, Zhou L, McGibbon MA, Taylor SI, et al. Physiological Role of Akt in Insulin-Stimulated Translocation of GLUT4 in Transfected Rat Adipose Cells. Molecular Endocrinology. 1997 Dec;11(13):1881–90.
    OpenUrlCrossRefPubMedWeb of Science
  50. 50.↵
    Prashanth G, Vastrad B, Tengli A, Vastrad C, Kotturshetti I. Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules. BMC Endocr Disord. 2021 Dec;21(1):80.
    OpenUrl
  51. 51.↵
    Yang Z, Cheng J, Shang P, Sun JP, Yu X. Emerging roles of olfactory receptors in glucose metabolism. Trends in Cell Biology. 2023 Jun;33(6):463–76.
    OpenUrl
  52. 52.↵
    Cheng J, Yang Z, Ge XY, Gao MX, Meng R, Xu X, et al. Autonomous sensing of the insulin peptide by an olfactory G protein-coupled receptor modulates glucose metabolism. Cell Metabolism. 2022 Feb;34(2):240–255.e10.
    OpenUrl
  53. 53.↵
    Wang K, Li WD, Glessner JT, Grant SFA, Hakonarson H, Price RA. Large Copy-Number Variations Are Enriched in Cases With Moderate to Extreme Obesity. Diabetes. 2010 Oct 1;59(10):2690–4.
    OpenUrlAbstract/FREE Full Text
  54. 54.↵
    Ding L, Han L, Dube J, Billadeau DD. WASH Regulates Glucose Homeostasis by Facilitating Glut2 Receptor Recycling in Pancreatic β-Cells. Diabetes. 2019 Feb 1;68(2):377–86.
    OpenUrlAbstract/FREE Full Text
  55. 55.↵
    Galli M, Hameed A, Żbikowski A, Zabielski P. Aquaporins in insulin resistance and diabetes: More than channels! Redox Biology. 2021 Aug;44:102027.
  56. 56.↵
    Méndez-Giménez L, Ezquerro S, Da Silva IV, Soveral G, Frühbeck G, Rodríguez A. Pancreatic Aquaporin-7: A Novel Target for Anti-diabetic Drugs? Front Chem. 2018 Apr 5;6:99.
  57. 57.↵
    Bekri S, Kispal G, Lange H, Fitzsimons E, Tolmie J, Lill R, et al. Human ABC7 transporter: gene structure and mutation causing X-linked sideroblastic anemia with ataxia with disruption of cytosolic iron-sulfur protein maturation. Blood. 2000 Nov 1;96(9):3256–64.
    OpenUrlAbstract/FREE Full Text
  58. 58.↵
    Schou J, Tybjærg-Hansen A, Møller HJ, Nordestgaard BG, Frikke-Schmidt R. ABC Transporter Genes and Risk of Type 2 Diabetes. Diabetes Care. 2012 Dec 1;35(12):2600–6.
    OpenUrlAbstract/FREE Full Text
  59. 59.↵
    Brunham LR, Kruit JK, Pape TD, Timmins JM, Reuwer AQ, Vasanji Z, et al. β-cell ABCA1 influences insulin secretion, glucose homeostasis and response to thiazolidinedione treatment. Nat Med. 2007 Mar;13(3):340–7.
    OpenUrlCrossRefPubMedWeb of Science
  60. 60.↵
    Frikke-Schmidt R. Association of Loss-of-Function Mutations in the ABCA1 Gene With High-Density Lipoprotein Cholesterol Levels and Risk of Ischemic Heart Disease. JAMA. 2008 Jun 4;299(21):2524.
    OpenUrlCrossRefPubMedWeb of Science
  61. 61.↵
    Bowman P, Flanagan SE, Edghill EL, Damhuis A, Shepherd MH, Paisey R, et al. Heterozygous ABCC8 mutations are a cause of MODY. Diabetologia. 2012 Jan;55(1):123–7.
    OpenUrlPubMed
  62. 62.↵
    Ovsyannikova AK, Rymar OD, Shakhtshneider EV, Klimontov VV, Koroleva EA, Myakina NE, et al. ABCC8-Related Maturity-Onset Diabetes of the Young (MODY12): Clinical Features and Treatment Perspective. Diabetes Ther. 2016 Sep;7(3):591–600.
    OpenUrl
  63. 63.↵
    Pujar M, Vastrad B, Kavatagimath S, Vastrad C, Kotturshetti S. Identification of candidate biomarkers and pathways associated with type 1 diabetes mellitus using bioinformatics analysis. Sci Rep. 2022 Jun 1;12(1):9157.
    OpenUrl
  64. 64.↵
    Jinfeng M, Kimura W, Hirai I, Sakurai F, Moriya T, Mizutani M. Expression of MUC5AC and MUC6 in Invasive Ductal Carcinoma of the Pancreas and Relationship With Prognosis. IJGC. 2004;34(1):09–18.
    OpenUrl
  65. 65.↵
    Mousa M, Albarguthi S, Albreiki M, Farooq Z, Sajid S, El Hajj Chehadeh S, et al. Whole-Exome Sequencing in Family Trios Reveals De Novo Mutations Associated with Type 1 Diabetes Mellitus. Biology. 2023 Mar 7;12(3):413.
    OpenUrl
Back to top
Posted October 04, 2024.
Download PDF
Data/Code
Email
Whole Exome Sequencing characterization of Maturity-Onset Diabetes of the Young (MODY) and Type 2 Diabetes Mellitus patients reveals polygenic features and novel genetic variants of risk for MODY in a Latino population
Alberto Moscona-Nissan, Daniel Marrero-Rodríguez, Sergio Andonegui-Elguera, Eduardo Salif Luna-Ávila, Florencia Martínez-Mendoza, Sandra Vela-Patiño, Itzel Ramírez-Ramos, Kapy S León-Wu, Regina De Miguel-Ibáñez, Moisés Mercado, Keiko Taniguchi-Ponciano, Aldo Ferreira-Hermosillo
medRxiv 2024.10.02.24314794; doi: https://doi.org/10.1101/2024.10.02.24314794
Twitter logo Facebook logo LinkedIn logo Mendeley logo
Citation Tools

Subject Area