Abstract
Autosomal Dominant Polycystic Kidney Disease is characterized by renal cyst development, often leading to kidney enlargement and failure. We conducted whole exome sequencing on 14 participants (12 families) from an Indian cohort. Our analysis revealed a spectrum of genetic variants, predominantly in the PKD1. These in PKD1 included missense variants such as p.Glu2937Lys (c.8809G>A) and p.Gly2310Arg (c.6928G>A), p.Asp2095Gly (c.6284A>G), p.Thr938Met (c.2813C>T), p.Trp967Arg (c.2899T>C), p.Glu593* (c.1777G>T), frameshift variants p.Gln149fs*141 (c.445delC), p.Ser3305fs*84 (c.9914_9915delCT), p.His1347fs*83 (c.4041_4042delCA), and p.Leu2776fs*87(c.8327_8363delTGGCGGGCGAGGAGATCGTGGCCCAGGGCAAGCGCTC), intronic splice site variant c.8017-3C>G, nonsense variant p.Glu593* (c.1777G>T) and in PKD2 missense variant p.Ser370Asn (c.1109G>A). While one individual carried intronic (c.2358+5G>A) and 3’UTR (c.*174G>T) variants in PKD2 only another individual carried variants in both PKD1 and PKD2, suggesting potential genetic complexity. Clinical data revealed diverse presentations. Age at diagnosis varied widely. Patients with frameshift variants exhibited earlier onset and severe manifestations, including bilateral ADPKD. One proband had right unilateral ADPKD. Involvement of liver, a common extra-renal manifestation, was also observed. Heterogeneity at phenotypic and at allelic level was observed in our cohort. In this study, using WES of a trio, a frameshift-truncation deletion [c.32del/p.Leu11ArgfsTer61] in MIOX was found to be associated with the disease shared by both the affected and early diagnosed mother and daughter carrying PKD1 missense variant, which had not been previously reported in ADPKD. Further, differential gene expression analysis using data from GEO database showed reduced MIOX expression in ADPKD cystic samples compared to minimal cystic tissues and controls. MIOX is an enzyme specific to renal tubules and catalyses the initial step of the kidney-based myoinositol catabolism. Both affected candidates also shared benign variants and other variations of uncertain significance which may influence the disease development. Further functional analysis will clarify how MIOX contributes to the disease. The study limitations include the small sample size and the need for validation in larger cohorts. Our findings highlight the importance of genetic analysis in ADPKD management especially to facilitate personalized therapeutic strategies.
Highlights
Identified variants in PKD1 and PKD2 through whole exome sequencing in ADPKD patients, affecting different protein regions.
Variants include non-synonymous coding changes, frame-shift deletions, and splice site alterations.
Clinical features and age at diagnosis varied widely, with common symptoms including flank pain, fatigue.
Frameshift deletion in MIOX, associated in one PKD1 trio, implicates its role in ADPKD pathogenesis.
DGE analysis of dataset from database reveals downregulation of MIOX in ADPKD tissue samples highlighting its role in potential molecular pathways in ADPKD progression.
Competing Interest Statement
The authors have declared no competing interest.
Funding Statement
This study was funded by the Department of Biotechnology (DBT), India, and the Indian Council of Medical Research (ICMR), India is providing Senior Research Fellowship to the first author
Author Declarations
I confirm all relevant ethical guidelines have been followed, and any necessary IRB and/or ethics committee approvals have been obtained.
Yes
The details of the IRB/oversight body that provided approval or exemption for the research described are given below:
The institutional Ethics committee of the Institute of Science, Banaras Hindu University gave ethical approval for this work
I confirm that all necessary patient/participant consent has been obtained and the appropriate institutional forms have been archived, and that any patient/participant/sample identifiers included were not known to anyone (e.g., hospital staff, patients or participants themselves) outside the research group so cannot be used to identify individuals.
Yes
I understand that all clinical trials and any other prospective interventional studies must be registered with an ICMJE-approved registry, such as ClinicalTrials.gov. I confirm that any such study reported in the manuscript has been registered and the trial registration ID is provided (note: if posting a prospective study registered retrospectively, please provide a statement in the trial ID field explaining why the study was not registered in advance).
Yes
I have followed all appropriate research reporting guidelines, such as any relevant EQUATOR Network research reporting checklist(s) and other pertinent material, if applicable.
Yes
Footnotes
This revised version of the manuscript contains several updates to enrich the study's depth and breadth. We have expanded our participant pool, now including data from additional individuals. Our variant analysis has been extended, offering more comprehensive insights into the genetic landscape of ADPKD by incorporating detailed information on variants identified in both the PKD1 and PKD2 genes. We have highlighted the involvement of MIOX in ADPKD pathogenesis, particularly emphasizing a trio WES study involving a double heterozygous mutation in MIOX and PKD1, shedding light on potential genetic interactions and their relevance to disease development.
Data Availability
All data produced in the present study are available upon reasonable request to the authors
