Egg-derived anti-SARS-CoV-2 immunoglobulin Y (IgY) with broad variant activity as intranasal prophylaxis against COVID-19: preclinical studies and randomized controlled phase 1 clinical trial

Study design

The experiments were conducted in 4 parts: 1) production of immunogen (recombinant RBD), immunization of 12 SPF hens, IgY collection from egg yolks, and in vitro characterization of the IgY anti-SARS CoV-2 RBD, 2) GLP blinded safety studies in rat, treated intranasally twice daily for 28 days with a total of 16 mg/kg IgY or vehicle, 3) a preliminary efficacy study of hamsters treated with IgY or phosphate-buffered saline (PBS) for 4 hours before viral challenge, and 4) a placebo-controlled, double-blind phase 1 safety, tolerability, and pharmacokinetic (PK) study conducted in healthy humans using intranasal IgY or vehicle in single-ascending doses followed by multiple doses (3-times daily every 4 hours) for 14 days. Both the single-ascending and multiple-dose parts were followed by a 7-day nontreatment period to further evaluate safety.

Recombinant SARS-CoV-2 RBD

SARS-CoV-2 RBD (residues 328-533) of the 2019 novel coronavirus index virus (2019- nCoV) was expressed in cell-free protein synthesis reactions at Sutro Biopharma, Inc. (South San Francisco, CA) using the XpressCF^TM platform [19, 20] and was constructed as a carboxy- terminal fusion to a small ubiquitin-related modifier (SUMO) sequence to enable the production of a tagless RBD protein post enzymatic cleavage. The his-SUMO tag was constructed as previously described with an N-terminal his6-tag followed by a GGS-linker and the yeast SUMO protein Smt3 for Ulp1-enabled cleavage [19, 20].

Briefly, cell-free reactions were prepared by the addition of 37.5% v/v iodoacetamide- treated S30 extract, 5 µg/mL plasmid, and a supermix containing amino acids, nano- microspheres, and small molecules for energy generation [20]. T7 RNA polymerase was over- expressed in Escherichia coli and added to the cell-free reaction as a reagent lysate at <1% v/v. Reactions were carried out in a DASbox stirred tank (Eppendorf) at 250 mL volume with pH, dissolved oxygen, and temperature control. Reactions were run for 16 hours at a temperature of 25°C, pH was controlled at 7.0 using 1 M citrate and 1 M potassium hydroxide, and dissolved oxygen was maintained at 20%.

The XpressCF reaction of SARS-CoV-2-RBD 328-533 was clarified by centrifugation at 10,000 rpm for 20 minutes (Beckman, JLA-10.500 rotor) and filtered through a 0.22-μm membrane filter. The clarified material was loaded onto a 5-mL his-Trap Excel affinity column equilibrated with binding buffer (15 mM Tris-HCl, 500 mM NaCl, pH 8.0). After 20 column volumes were applied to wash unbound impurities, the bound proteins were eluted with 20 mM Tris-HCl, 300 mM imidazole, pH 8.0. The eluted fractions were then analyzed by 4-12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and protein concentrations were determined by measured absorbance at 280 nm by NanoDrop (Thermo Fisher Scientific).

The his-SUMO tag was removed by Ulp1 protease digestion for 1 hour at room temperature. The digested reaction was analyzed by 4-12% SDS-PAGE to verify full cleavage of the his-SUMO tag before flow-through mode purification by Capto Q (Cytiva). Twenty mM Tris-HCl, pH 8.0, was used to equilibrate the column, and the flow-through containing the cleaved protein was collected. To further purify the CoV-2-RBD, the Capto Q flow-through fraction was bound to a Capto SP ImpRes cation column equilibrated with 20 mM Tris-HCl, pH 8.0. The bound protein was eluted with a 30-column volume linear gradient using elution buffer (20 mM Tris-HCl, 300 mM NaCl, pH 8.0). An Amicon Ultra-15, 3kD centrifugal filter was used to concentrate and buffer exchange the target peak fraction into 6% sucrose in PBS at pH 7.2. The final purity of the product was demonstrated by high-performance liquid chromatography (HPLC) analysis.

Characterization of the cell-free expressed recombinant RBD using surface plasmon resonance

Binding kinetic of cell-free expressed SARS-CoV-2 RBD construct or mammalian expressed his-tagged RBD control (ACROBiosystems SPD-C52H1) were then measured on a Biacore T200 instrument, using Fc-tagged hACE2 receptor protein (ACROBiosystems AC2-H5257). To this end, an anti-human Fc antibody (Jackson ImmunoResearch Labs) was immobilized on all flow cells of a CM5 chip (GE Healthcare). Fc-tagged human ACE2 receptor protein (ACROBiosystems AC2-H5257) was captured at ∼100 replication units (RU). Binding of cell- free expressed SARS-CoV-2 S protein RBD construct or mammalian expressed RBD control (ACROBiosystems SPD-C52H1) was measured at concentrations up to 100 nM. Kinetic experiments were performed at 25°C at a flow rate of 50 μL/min. RBD samples were diluted in HBS-EP buffer (Teknova) and injected over the chip for 180 seconds followed by a 420-second dissociation. The chip was regenerated with 10 mM glycine pH 1.5 after each injection.

Affinities were calculated using Biacore T200 Evaluation Software.

Hen immunization and IgY purification and characterization

Nine SPF hens were obtained from Charles River Laboratories and housed in a filtered air, positive pressure barrier room (3 more hens from the same lot were added to the study after 5 months) at Avian Vaccine Services, Charles River Laboratories (Storrs, CT). Each hen was caged individually with access to feed and water. Upon receipt, hens were immunized with an inoculum containing 50 µg of recombinant cell-free expressed RBD fragment derived from S1 spike protein and water-in-oil adjuvant. Test bleeds were taken before the first immunization and every 2 weeks after the first immunization throughout the project. Serum samples from each hen were tested using an indirect enzyme-linked immunoassay (ELISA) and Western blot. Hens received a boost 14 days after immunization and every 4 weeks after the previous immunization, unless otherwise indicated.

Eggs were collected weekly. Yolks in batches up to 100 eggs/batch were separated and IgY was purified. ELISA titration of IgY binding to full-length S1 (ACROBiosystems, S1N- C5255) expressed in human 293 cells and the cell-free expressed RBD of the SARS-CoV-2 spike protein was performed in 96-well plates. IgY was then purified from yolks. Eggs were collected weekly and egg white was separated from the egg yolk and discarded. Yolks were stored frozen at -20°C. For purification of IgY, yolks were thawed and diluted 1:10 in sterile PBS. The pH was reduced to 5.0 and the yolk solution was incubated at 4°C overnight. Yolk solution was then centrifuged for 10 minutes at 9000 rpm. Supernatant was removed, pooled, pH was increased to 7.0, and final filtration (0.45 µm) was performed.

Hen sera and purified IgY were tested by ELISA and Western blot analysis using both the immunogen (RBD) and full length glycosylated S1 protein (ACROBiosystems, cat# S1N- C5255). Lot Y0120 of purified IgY was derived from 50 yolks, starting 2 weeks after the primary immunization. Lot Y0130 was derived from the next 50 yolks, starting 3 weeks after the primary immunization. Lot Y0140 and above were derived from the next 100 yolks collected over the preceding 2 weeks. Lots of purified IgY were tested by indirect ELISA and Western blot to determine antibody response levels within the yolk after purification as well as affinity to the cell-free expressed RBD fragment of S1 spike protein and the entire glycosylated S1 protein (ACROBiosystems, cat# S1N-C5255). Protein concentration was also measured using the Bradford assay. IgY purity was determined using SDS-PAGE under reducing conditions and stained with Coomassie Blue.

ELISA titration of IgY binding to full length and the RBD of the SARS-CoV-2 spike protein was performed as follows: 96-well clear flat bottom polystyrene high-binding ELISA plates (Corning, Cat# 9018) were coated with 100 μl/well of 5 μg/mL recombinant his-tagged (Sino Biological) RBD protein overnight at 4°C. Plates were then washed twice with PBS and blocked with 1% bovine serum albumin (BSA)-PBS. After blocking, 100 μL of serial dilutions of IgY were added to the wells and incubated at room temperature for 2 hours. The plates were then washed twice and incubated with horseradish peroxidase (HRP)-conjugated mouse rat anti- chicken IgY (Sapphire, Cat# LO-IgY-16-P-0.5 ) 1:2000 diluted in 0.5% BSA and 0.05% Tween- 20 in PBS) for 60 minutes. After 3 final washes using 0.05% PBS-Tween, the plates were read using chemiluminescent substrate (Pierce TMB Substrate Kit, Thermo Fisher, Cat# 34021).

Luminescence was read on a plate reader and analyzed with SoftMaxPro 6.0 (Molecular Devices).

Hen sera were diluted with 1% BSA at various dilutions and tested in ELISA. One hundred microliters were added to wells and the plate was incubated at room temperature for 1 hour. Plate wells were then rinsed with 1% Tween 20 wash solution, as indicated above. Anti- chicken HRP conjugate (Invitrogen, cat# SA-19509) diluted 1:5000 was added to each well. The plate was incubated at room temperature for 1 hour, followed by another 1% Tween 20 wash.

3,3′,5,5′-tetramethylbenzidine substrate (KPL, cat# 5120-0050) was added to each well and the plate was incubated at room temperature for 15 minutes. Optical density was measured using an ELISA reader (Molecular Devices) at 650 nm.

Western blot analysis was performed with the cell-free expressed RBD fragment of the index S1 protein or the entire mammalian-expressed S1 protein (ACROBiosystems). One microgram of denatured protein was added to Mini-PROTEAN TGX 4-20% SDS-PAGE. Gel was run at 200V for 45 minutes in Tris-glycine buffer and stained using Simply Blue Safestain (Invitrogen) at room temperature for 1 hour. Gels were destained twice using deionized water.

An unstained SDS-PAGE gel was transferred to the polyvinylidene difluoride membrane using Trans-Blot Turbo Transfer System (Bio-Rad Laboratories) and cut into strips. Strips were then stored at -20°C until ready to use. Five percent nonfat dry milk was added to strips and incubated at room temperature for 30-60 minutes. Test bleed sera and IgY were diluted 1:2000 and purified IgY were diluted 1:500 in 0.2 µm-filtered PBS and added to strips. Strips were incubated at room temperature for 2 hours followed by 3 washes in filtered PBS. Rabbit anti- chicken IgY (H+L) secondary antibody, HRP (Invitrogen) diluted 1:3000 was added to each strip and incubated at room temperature for 1-2 hours. Strips were washed once again in filtered PBS. Opti-4CN substrate (Bio-Rad Laboratories) was added to each strip and incubated at room temperature for up to 30 minutes in a rocking incubator. Strips were washed twice in deionized water and images were taken using Bio-Rad EZ Gel Imager.

ELISA evaluation of IgY titer against SARS-CoV-2 variants of concern

ELISA titer of the final IgY preparation used in the clinical studies against the Alpha, Beta, Delta, and Omicron-derived RBD [amino acids 319-537; ACROBiosystems SPD-C52H1(index), SPD-C52Hn (Alpha), SPD-C52Hp (Beta), SPD-C525e (Delta), and SPD-C522e (Omicron)]) was carried out as described above.

In culture viral neutralization studies using pseudovirus

The neutralization assays using pseudovirus were performed at RetroVirox (San Diego, CA). The assay used 3 non-replicative vesicular stomatitis virus (VSV) pseudoviruses carrying a firefly luciferase reporter gene and expressing the following S protein of SARS-CoV-2 on the surface: the index SARS-CoV-2 Hu-1 spike, a truncated spike with a C-terminal 19 amino acid deletion; the Beta variant (K417N/ E484K / N501Y / D614G full-length spike); and a D614G spike variant with a full-length sequence of the index spike protein. The IgY preparation or plasma was diluted in Dulbecco’s Modified Eagle Medium (DMEM) with 5% fetal bovine serum (FBS) to perform pre-incubation with pseudovirus before addition to target cells. The neutralization assay was performed with HEK 293T-hACE2, a human embryonic kidney cell line overexpressing hACE2. Test item was preincubated for 60 minutes at 37°C with a previously titrated inoculum of pseudovirus. The mixture was then added to 293T-hACE2 cells and infection was allowed for 24 hours. Pseudovirus infection was determined by measuring firefly luciferase activity (RLU, relative light unit ratio) 24 hours after infection. Putative neutralizing antibodies (human sera, purified IgY, or vehicle) were present in the cell culture for the entire duration of the experiment. The ability of the test item to neutralize pseudovirus carrying SARS-CoV-2 spike was compared with samples treated with vehicle alone. Nine concentrations of the IgY sample were tested in duplicates with each variant in 5-fold serial dilutions starting at 10,000 μg/mL. The half-maximal inhibitory concentration (IC50) and 50% neutralization titer (NT50) values for the IgY and positive control human serum were determined using GraphPad Prism software (GraphPad Software).

Quality controls for the pseudovirus neutralization assays were performed to determine: 1) signal-to-background values; 2) variation of the assay, estimated as the average of the coefficient of variation for data points for which 50% or greater infection (RLUs) was observed compared to cells with pseudovirus in the presence of vehicle alone, and 3) neutralization with plasma from an individual who received 2 doses of the Moderna (mRNA-1273) COVID-19 vaccine. All controls worked as anticipated for each assay.

In culture neutralization studies using live virus

At United States Army Medical Research Institute of Infectious Diseases (USAMARIID; Frederick, MD), all work with authentic (live) SARS-CoV-2 was completed in Biosafety Level 3 laboratories following federal and institutional biosafety standards and regulations. Vero-76 cells were inoculated with SARS-CoV-2/Was1 (MT020880.1) at a multiplicity of infection of 0.01 and incubated at 37°C with 5% CO2 and 80% humidity. At 50 hours post-infection, cells were frozen at -80°C for 1 hour, allowed to thaw at room temperature, and supernatants were collected and clarified by centrifugation at ∼2,500 ×g for 10 minutes. Clarified supernatant was aliquoted and stored at -80°C.

Authentic (live) SARS-CoV-2/B.1.617.2 at a multiplicity of infection of 1 was incubated for 1 hour at 37°C with serially diluted antibodies. Vero-E6 monolayers were exposed to the antibody-virus mixture at 37°C for 1 hour. Following incubation, viral inoculum was removed and fresh cell culture media was added for an additional 23 hours at 37°C. Cells were washed with PBS, fixed in 10% formalin, and permeabilized with 0.2% Triton-X for 10 minutes.

Detection of infection was accomplished using an anti-SARS-CoV-2 nucleocapsid protein detection antibody (Sino Biological), and a goat α-rabbit secondary antibody conjugated to AlexaFluor488. Infected cells were identified using the PerkinElmer Operetta high-content imaging instrument and data analysis was performed using the Harmony software (PerkinElmer).

At RetroVirox (San Diego, CA), purified IgY (lot Y0180) was tested against two live SARS-CoV-2 clinical isolates: MEX-BC15/2021 (lineage B.1.617.2, Delta variant) and MEX-BC2/2020 (lineage B.1, carrying the D614G mutation). A virus-induced cytopathic effect (CPE)- based neutralization assay was performed by infecting Vero E6 cells in the presence or absence of test items. Vero E6 cells were maintained in DMEM with 10% FBS. Twenty-four hours after cell seeding, test samples were submitted to serial dilutions with DMEM with 2% FBS in a different plate. Then, virus diluted in the same media alone was pre-incubated with test items for 1 hour at 37°C in a humidified incubator. Following incubation, media was removed from cells. Cells were then challenged with the SARS-CoV-2/antibody pre-incubated mix. The amount of viral inoculum was previously titrated to result in a linear response inhibited by antivirals with known activity against SARS-CoV-2. Cell culture media with the virus inoculum was not removed after virus adsorption, and antibodies and virus were maintained in the media for the duration of the assay (96 hours). After this period, the extent of cell viability was monitored with the neutral red uptake assay.

The virus-induced CPE was monitored under the microscope after 3 days of infection, and cells were stained with neutral red to monitor cell viability the following day. Viable cells incorporate neutral red in their lysosomes. The uptake of neutral red relies on the ability of live cells to maintain the pH inside the lysosomes lower than in the cytoplasm, a process that requires ATP. Inside the lysosome, the dye becomes charged and is retained. After a 3-hour incubation with neutral red (0.017%), the extra dye is washed away, and the neutral red is extracted from lysosomes by incubating cells for 15 minutes with a solution containing 50% ethanol and 1% acetic acid. The amount of neutral red is estimated by measuring absorbance at 540 nm in a plate reader.

Antibodies were evaluated in triplicates using five-fold serial dilutions starting at 10.0 mg/mL. Controls included uninfected cells and infected cells treated with vehicle alone. Some cells were treated with plasma from an uninfected individual who received two doses of Moderna’s mRNA COVID-19 vaccine as a positive control.

CPE-based neutralization assay

The average absorbance at 540 nm (A540) observed in infected cells in the presence of vehicle alone was calculated, and then subtracted from all samples to determine the inhibition of the virus-induced CPE. Data points were then normalized to the average A540 signal observed in uninfected cells after subtraction of the absorbance signal observed in infected cells. In the neutral red CPE-based neutralization assay, uninfected cells remained viable and uptake the dye at higher levels than non-viable cells. In the absence of test items, the virus-induced CPE kills infected cells and leads to lower A540 (this value equals 0% inhibition). In contrast, incubation with neutralizing agents prevents the virus-induced CPE and leads to absorbance levels similar to those observed in uninfected cells. Full recovery of cell viability in infected cells represents 100% neutralization of the virus.

GMP IgY formulation, analytical studies, and stability

Using Good Manufacturing Practice (GMP), anti-S1 RBD IgY was formulated for use as intranasal drops as 0 (placebo control), 5, 10, and 20 mg/mL anti-S1 RBD IgY preparations in sterile 2% microcrystalline cellulose and carboxymethylcellulose sodium at Bravado Pharmaceuticals (Lutz, FL). The suspension was packed in a 1.5-mL dropper bottle and tests for GMP drug product release complied with the relevant standards and methods, including microbiological examination of nonsterile products (USP <1111>, <61> and <62>). All formulated products were 100% stable as measured by physical and analytical properties, including HPLC, when stored for at least 6 months at 2-8°C and about 1 month when stored at room temperature. Ten and 20 mg/mL solutions stored at room temperature showed 100% analytical stabilities for 3 months. However, several samples had some physical visual abnormalities (slight discoloration and opacity) that occurred beginning at 1 month when stored at room temperature. Therefore, all formulated samples used in the subsequent studies were stored at 2-8°C. For stability determination, formulated IgY (20 mL) was chromatographed on a TSK Gel G3000swxl sizing column (with guard column) on HPLC at 0.4 mL/min at room temperature, and eluate was monitored at 214 nm. For the rat toxicity and safety study, and for the human study, we used only 20 mg/mL as the highest dose because it was readily soluble.

GLP rat toxicity and safety study

Thirty-eight female and 38 male >8-week-old Sprague Dawley rats were used in a GLP study conducted at Charles River Laboratories (Spencerville, OH). Rats were identified using a subcutaneously implanted electronic identification chip and were acclimated to their housing for at least 4 days before the first day of dosing. Animals were randomly assigned to groups; males and females were randomized separately and housed in accordance with the USDA Animal Welfare Act (9 CFR, Parts 1, 2 and 3) and as described in the Guide for the Care and Use of Laboratory Animals.

For psychological and environmental enrichment, a hiding device, a chewing object, and edible enrichment treats were offered throughout the study and a cycle of 12 hours light and 12 hours dark was maintained. Water and food were freely available. The experimental protocol is summarized in S1-S3 Tables.

Detailed clinical observation was conducted once a week and included body weight and food consumption. Ophthalmic examinations were conducted before treatment and during the last week of dosing by a veterinary ophthalmologist and included a short-acting mydriatic solution treatment to each eye to facilitate the ocular examinations. Clinical laboratory assessments included hematology, coagulation, clinical chemistry, urinalysis, and presence of circulating IgY (in serum) tested on pretreatment and Day 28 (last day of treatment) after 4 hours of fasting. Hematology parameters included red blood cell count, hemoglobin concentration, hematocrit, mean corpuscular volume, red blood cell distribution width, mean corpuscular hemoglobin concentration, mean corpuscular hemoglobin, reticulocyte count (absolute), platelet count, white blood cell count, neutrophil count (absolute), lymphocyte count (absolute), monocyte count (absolute), eosinophil count (absolute), basophil count (absolute), large unstained cells (absolute) and other cells (as appropriate). Clinical chemistry parameters included alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, gamma- glutamyltransferase, creatine kinase, total bilirubin, urea nitrogen, creatinine, calcium, phosphorus, total protein, albumin, globulin (calculated), albumin/globulin ratio, glucose, cholesterol, triglycerides, sodium, potassium, chloride, and sample quality. Urinalysis included color, appearance/clarity, specific gravity, volume, pH, protein, glucose, bilirubin, ketones, and blood.

Cytokine level measurement and analysis

This non-GLP blinded assay was performed on serum by the Immunoassay Team at the Human Immune Monitoring Center at Stanford University (Stanford, CA). Assay kits (RECYMAG65K27PMX Rat) were purchased from EMD Millipore and used according to the manufacturer’s recommendations, with modifications described as follows. Briefly, samples were mixed with antibody-linked magnetic beads on a 96-well plate and incubated overnight at 4°C while shaking. Cold and room temperature incubation steps were performed on an orbital shaker at 500-600 rpm. Plates were washed twice with wash buffer in a Biotek ELx405 washer.

Following 1-hour incubation at room temperature with a biotinylated detection antibody, streptavidin-PE was added for 30 minutes while shaking. Plates were washed as described above and PBS was added to wells for reading in the Luminex FLEXMAP 3D Instrument with a lower bound of 50 beads per sample per cytokine. Each sample was measured in duplicate. Custom Assay Chex control beads were purchased from Radix BioSolutions and added to all wells.

Median fluorescence intensity (MFI) data were corrected for plate and nonspecific binding artifacts [20]. Corrected MFI was regressed on time point. Regression analysis employed linear mixed models [21] in SAS®/STAT (SAS Institute) with a separate model fit for each treatment and cytokine, and with separate sets of models with and without gender as a covariate, for 108 models in total. Of the 108 models, 84% met the assumption of normally distributed residuals and 78% for random effects.

IgY in sera of treated rats

The presence of anti-SARS-CoV-2 IgY in sera of rats was evaluated using GLP standards in a qualified ELISA assay at Charles River Laboratories (Reno, NV). ELISA 96-well plates were coated with goat anti-chicken IgY (Thermo Fisher; A16056). After blocking, the plates were incubated with the samples containing anti-SARS-CoV-2 IgY at various concentrations for 1 hour at room temperature. After washing the microplate, rabbit anti-chicken IgY (Thermo Fisher; A16130) - HRP conjugate was added and incubated for 1 hour at room temperature. The ELISA plate was washed and substrate (3,3’,5,5’-tetramethylbenzidine) was added to the wells and incubated for 20 minutes. The color development was stopped by the addition of 2N sulfuric acid and color intensity measured in a microplate reader at 450 nm. A calibration curve from the absorbance values was obtained from the standards using a 4-parameter curve fit with a weighting equation of 1/y2. The concentrations of anti-SARS-CoV-2 IgY in the samples were determined from the calibration curve. After 4 analytical method validations, lower and upper limit of detection, intra- and inter-assay precision and accuracy, dilution integrity, and short-term stability, IgY levels in the blood samples of rats before and after 28 days of treatment were below the limit of detection.

Human tissue cross-reactivity study

A GLP study examining human tissue reactivity of the anti-SARS-CoV-2 RBD IgY was conducted at Charles River Laboratories (Frederick, MD) using at least 3 tissues from at least 3 donors (S4 Table). Ten mL of 10 mg/mL or 20 mg/mL IgY control (negative control) and anti- SARS-CoV-2 RBD IgY or an anti-human hypercalcemia of malignancy peptide (amino acid residues 1-34, Sigma-Aldrich; Catalog No. H9148; positive control), each in 1% BSA, were incubated for 1 hour with acetone-fixed human tissues (normal) of at least 3 separate donors after 20 minutes incubation with block solution of PBS + 1% BSA, 0.5% casein and 5% normal rabbit serum. After PBS washes, the secondary antibody (peroxidase [HRP]-conjugated rabbit anti- chicken IgY; Testing Facility antibody tracking No. A45764; of 2 μg/mL) was added for 30 minutes. After PBS washes, DAB (3,3′-diaminobenzidine) was applied for 4 minutes as a substrate for the peroxidase reaction. All slides were rinsed with tap water, counterstained, dehydrated, and mounted for visualization. For the β2-microglobulin antibody (positive control staining) 1 μg/mL of antibodies were incubated with the slides for 1 hour and bound antibodies were detected with biotinylated secondary antibody (goat anti-rabbit IgG; 2 μg/mL) for 30 minutes, as above. The slides were then visualized on light microscopy.

Virus preparation for the efficacy study in a hamster model of COVID-19 and quantitation of viral load in the animals

Syrian hamsters develop mild-to-moderate disease with progressive weight loss that starts several days after SARS-CoV-2 infection by intranasal inoculation [22, 23]. SARS-CoV-2 (strain 2019-nCoV/USA-WA1/2020) was propagated on Vero-TMPRSS2 cells, and the virus titer was determined by plaque assays on Vero-hACE2 and Vero-hACE2-TMPRSS2 cells. Briefly, cells were seeded in 24-well plates, and the next day, virus stocks were serially diluted 10-fold, starting at 1:10, in cell infection medium [Minimum Essential Media (MEM) containing 2% FBS, L-glutamine, penicillin, and streptomycin]. Two hundred and fifty microliters of the diluted virus were added to a single well per dilution per sample. After 1 hour at 37°C, the inoculum was aspirated and a 1% methylcellulose overlay in MEM supplemented with 2% FBS was added.

Seventy-two hours after virus inoculation, the cells were fixed with 4% formalin and the monolayer was stained with crystal violet (0.5% w/v in 25% methanol in water) for 1 hour at 20°C. The number of plaques was counted and used to calculate the plaque-forming units (PFU)/mL.

Study protocol: hamster infection with SARS-CoV-2

Five- to 6-week-old Syrian golden hamsters (Charles River Laboratories) infected with SARS- CoV-2 as previously described [23] were housed at the Washington University (St. Louis, MO) Biosafety Level 3 facility in HEPA-filtered rodent cages. Before challenge with SARS-CoV-2, all animals received 100 μL of a placebo control fluid or fluid-formulated anti-SARS-CoV-2 RBD IgY (1 mg/50 mL of the 20 mg/mL solution per nare). The amount of nasal anti-SARS- CoV-2 RBD IgY drops was limited by the volume that could be given per nare. Four hours after the delivery, animals were challenged with 10⁴ or 5 x 10⁴ PFU of SARS-CoV-2 (titer determined on Vero-hACE2; see below). The protocol included 18 hamsters in 4 planned groups: Group 1: Control with high 5 x 10⁴ PFU (4 animals); Group 2: Control with 1 x 10⁴ PFU (4 animals);

Group 3: Anti-SARS-CoV-2 RBD IgY with 5 x 10⁴ PFU (5 animals); and Group 4: Anti-SARS-CoV-2 RBD IgY with 1 x 10⁴ PFU (5 animals). Note that the viral titer in Vero-hACE2- hTMPRSS2 cells, which express the essential protease to liberate the RBD from the S protein on the surface of the virus [24], was subsequently found to be almost 100-fold higher for Groups 1 and 3 (4 x 10⁶ PFU) and Groups 2 and 4 (0.8 x 10⁶ PFU).

Animal weight was recorded daily. Three days after challenge, the animals were sacrificed and lungs were collected. The left lobe was homogenized in 1.0 mL of DMEM and the clarified supernatant was used for viral load analysis by plaque assay and quantitative reverse transcription PCR (RT-qPCR).

Virus titration assays from hamster samples

Plaque assays were performed on Vero-hACE2 and Vero-hACE2-TMPRSS2 cells in 24-well plates. Lung tissue homogenates were serially diluted 10-fold, starting at 1:10, in cell infection medium (DMEM containing 2% FBS, L-glutamine, penicillin, and streptomycin). Two hundred and fifty microliters of the diluted lung homogenates were added to a single well per dilution per sample. After 1 hour at 37°C, the inoculum was aspirated and a 1% methylcellulose overlay in MEM supplemented with 2% FBS was added. Seventy-two hours after virus inoculation, the cells were fixed with 4% formalin, and the monolayer was stained with crystal violet (0.5% w/v in 25% methanol in water) for 1 hour at 20°C. The number of plaques was counted and used to calculate the PFU/mL. To quantify viral load in lung tissue homogenates, RNA was extracted from 100 µL samples using QIAamp viral RNA mini kit (Qiagen) and eluted with 50 µL of water. RNA (4 µL) was used for real-time RT-qPCR to detect and quantify N gene of SARS- CoV-2 using TaqMan™ Fast Virus 1-Step Master Mix (Applied Biosystems) or using the following primers and probes for the N-gene, forward: GACCCCAAAATCAGCGAAAT; reverse: TCTGGTTACTGCCAGTTGAATCTG, probe: ACCCCGCATTACGTTTGGTGGACC, or the 5’-UTR, forward: ACTGTCGTTGACAGGACACG, reverse: AACACGGACGAAACCGTAAG, probe: CGTCTATCTTCTGCAGGCTG. Viral RNA was expressed as gene copy numbers per mg for lung tissue homogenates and per mL for nasal swabs, based on a standard included in the assay that was created by in vitro transcription of a synthetic DNA molecule containing the target region of the N gene or 5’-UTR.

Statistical Analysis

Data were analyzed with GraphPad Prism 9.0 and statistical significance was assigned when P values were < 0.05. All tests and values are indicated in figure legends.

Phase 1 safety, tolerability, and pharmacokinetic study in humans

Study design and dose selection

A single-center, randomized, double-blind, placebo-controlled phase 1 study of anti-SARS-CoV- 2 RBD IgY given intranasally to 48 healthy adults was conducted at Linear Clinical Research- Harry Perkins Research Institute (Perth, WA, Australia) (Fig. 1, S1 CONSORT Checklist).

• Download figure
• Open in new tab

Figure 1.

CONSORT flow diagram of phase 1 single-ascending and multiple-dose study

Written informed consent was obtained from all participants. The study is registered at ClinicalTrials.gov: NCT04567810. The study period was conducted between September 25, 2020 and December 14, 2020. The protocol for this trial and the supporting CONSORT checklist are available as supporting information (S1 Protocol and S1 CONSORT checklist).

The primary objective of the study was to assess the safety and tolerability of anti-SARS- CoV-2 IgY. A secondary objective was to assess the PK of anti-SARS-CoV-2 IgY. Evaluation of immunoglobulin E (IgE) and anti-IgE antibodies was an exploratory objective.

Healthy male and female participants ≥18 and ≤ 45 years old with a body weight ≥ 50 kg and a body mass index ≥ 18.0 and ≤ 32.0 kg/m² were eligible for this study. Females of childbearing potential who were pregnant or lactating or planning to become pregnant during the study and participants with a history of alcohol and drug abuse, current smoking, clinically significant laboratory abnormalities, history of nasal surgical procedures, frequent or recurrent nasal conditions, current use of any nasal preparations, evidence of or history of clinically significant conditions, or positive test for hepatitis B, hepatitis C, human immunodeficiency virus, or SARS-CoV-2 nucleic acid or serology were excluded from participation. Full eligibility criteria are summarized in S1 Protocol.

The master randomization schedule and the associated code break envelope files were produced by an unblinded statistician using a computer-generated (SAS® v9.4 PLAN procedure) pseudo-random permutation procedure. For Part 1, the first two randomization numbers for each cohort were randomly assigned in a 1:1 ratio (anti-SARS-CoV-2 IgY: Placebo) to allow for sentinel dosing, and the remainder of the numbers for each cohort was generated in a 5:1 (anti- SARS-CoV-2 IgY: Placebo) ratio using a permuted blocked randomization with a block size of six. For Part 2, 24 numbers were generated in a 1:1:1:1 ratio (6 mg anti-SARS-CoV-2 IgY: 12 mg anti-SARS-CoV-2 IgY: 24 mg anti-SARS-CoV-2 IgY: Placebo) using a permuted blocked randomization with a block size of six. The block sizes were kept confidential during the study.

The site personnel randomized eligible participants on Day 1 by assigning the next available randomization number for the specific study part to the participant and reporting the randomization number on the case report form. Study drug was prepared by an unblinded pharmacist based on the treatment corresponding to the assigned randomization number on the randomization schedule that was only available to the pharmacist. In the event of an emergency, authorized personnel were able to unblind a participant through the code break envelope associated with the randomization number assigned to the participant.

In Part 1, participants were randomly assigned to receive a single dose of anti-SARS- CoV-2 RBD IgY antibodies or placebo in a sequential escalating manner. Three groups were sequentially dosed with 8 healthy participants per group (6 active and 2 placebo in each group). Each group in Part 1 included the initial dosing of a sentinel group (1 anti-SARS-CoV-2 RBD IgY and 1 placebo) at least 24 hours before dosing the remaining 6 participants in the cohort (5 anti-SARS-CoV-2 RBD IgY and 1 placebo). The remainder of the cohort were dosed if, in the opinion of the investigator, there were no significant safety concerns identified in the sentinel participants within the first 24 hours after administration of the dose (anti-SARS-CoV-2 RBD IgY or placebo). A Safety Monitoring Committee (SMC) reviewed safety data before each dose escalation. The following regimens were administered: 2 mg anti-SARS-CoV-2 RBD IgY preparation or placebo, 4 mg anti-SARS-CoV-2 RBD IgY preparation or placebo, and 8 mg anti- SARS-CoV-2 RBD IgY preparation or placebo. In Part 1, 2 drops were applied to each nostril as a single administration. A 7-day nontreatment follow-up period assessed safety after completion of the dosing.

In Part 2, participants were randomly assigned to receive multiple daily administrations of anti-SARS-CoV-2 RBD IgY or placebo every 4 hours (3-times daily) for 14 days in a parallel- group manner. Up to 24 healthy participants were randomized to 1 of 4 treatment regimens (6 participants per regimen). The following regimens were administered: 6 mg total daily dose anti- SARS-CoV-2 RBD IgY preparation for 14 days, 12 mg total daily dose anti-SARS-CoV-2 RBD IgY preparation for 14 days, 24 mg total daily dose anti-SARS-CoV-2 RBD IgY preparation for 14 days, and 0 mg total daily dose placebo preparation for 14 days. In Part 2, 2 drops were applied to each nostril every 4 hours (3-times daily). A 7-day nontreatment follow-up period assessed safety after completion of the dosing.

In each part, 3 groups with 8 healthy participants per group (6 active and 2 placebo in each group) were dosed. Safety and tolerability were evaluated using adverse event, physical examination (including vital signs), electrocardiogram, and clinical laboratory data. PK of anti- SARS-CoV-2 RBD IgY was evaluated by measuring serum concentrations pretreatment and at Day 14 when given as multiple doses administered intranasally for 14 days.

The investigational drug was supplied as a liquid preparation in a nose drop bottle containing 1.5 mL anti-SARS-CoV-2 RBD IgY preparation nasal suspension at 5, 10, or 20 mg/mL, or placebo, for intranasal application. Each bottle of nasal drops had enough material for one day of use. The liquid preparation contained anti-SARS-CoV-2 RBD IgY 0.5 mg/100 µL/drop, 1 mg/100 µL/drop, or 2 mg/100 µL/drop. The total maximum daily dose of anti-SARS- CoV-2 RBD IgY used in the present study (24 mg) was based in part on solubility considerations and is less than the daily dose of anti- Pseudomonas aeruginosa IgY previously given prophylactically as an oral treatment to prevent pulmonary infections in 17 patients with cystic fibrosis [25]. For the maximum anti-SARS-CoV-2 RBD IgY dose of 4 mg/nare, we calculated a favorable ratio of IgY to viral particles, even when virus covers the nasal pathway.

All participants were provided with a Dose Administration Guide and instructed to “Gently blow your nose before using this drug. Then tilt your head back while sitting or lying down. After the study drug is administered, keep your head tilted for a few minutes. Try not to blow your nose for at least 5 minutes after study drug administration.”

GLP bioanalytical analysis of IgY in blood samples – toxicokinetic analysis

The presence of anti-SARS-CoV-2 IgY in sera of study participants was evaluated using GLP standards in a qualified ELISA assay at Charles River Laboratories (Reno, NV). ELISA 96-well plates were coated with goat anti-chicken IgY (Thermo Fisher; A16056) and, after blocking, were incubated with the samples containing anti-SARS-CoV-2 IgY at various concentrations for 1 hour at room temperature. After washing the microplate, rabbit anti-chicken IgY (Thermo Fisher; A16130) - HRP conjugate was added and incubated for 1 hour at room temperature. The ELISA plate was washed and substrate (3,3’,5,5’-tetramethylbenzidine) was added to the wells and incubated for 20 minutes. The color development was stopped by the addition of 2N sulfuric acid and color intensity measured in a microplate reader at 450 nm. A calibration curve from the absorbance values was obtained from the standards using a 4-parameter curve fit with a weighting equation of 1/y2. The concentrations of anti-SARS-CoV-2 IgY in the samples were determined from the calibration curve. After 4 analytical method validations, lower and upper limit of detection, intra- and inter-assay precision and accuracy, dilution integrity, and short-term stability, IgY levels in study participants before and after 14 days of treatment were below the limit of detection.

Good Laboratory Practice

The study was performed at Charles River Laboratories following the U.S. Department of Health and Human Services, Food and Drug Administration (FDA), United States Code of Federal Regulations, Title 21, Part 58: Good Laboratory Practice for Nonclinical Laboratory Studies and as accepted by Regulatory Authorities throughout the European Union (OECD Principles of Good Laboratory Practice), Japan (MHLW), and other countries that are signatories to the OECD Mutual Acceptance of Data Agreement.

Animal welfare assurance and standards

The protocols and any amendment(s) or procedures involving the care and use of animals (hen immunization and rat tolerability studies) were reviewed and approved by Charles River Laboratories Institutional Animal Care and Use Committee before conduct. The hamster efficacy study was carried out following the recommendations in the Guide for the Care and Use of

Laboratory Animals of the National Institutes of Health and the protocol was approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (assurance number A3381–01). Stanford Institutional Animal Care and Use Committee did not review the research.

Regulatory and ethics considerations

Ethical review of the clinical trial protocol and any amendments was obtained by Bellberry Human Research Ethics Committee (the Australian National Review Board) and the clinical trial was conducted solely at Linear Clinical Research, Perth Australia. Stanford Institutional Review Board did not review the research. The study was conducted following the protocol and ethical principles stated in the 2013 version of the Declaration of Helsinki and the applicable guidelines on Good Clinical Practice, and all applicable federal, state, and local laws, rules, and regulations.

Antigen production

The overall scheme describing the production of anti-SARS CoV-2 IgY antibody to be used as intranasal prophylaxis in humans is shown in Figure 2A. We produced a recombinant protein to immunize hens. A tagless RBD of SARS-CoV-2 (Fig. 2B; index SARS-CoV-2 variant), amino acids 328-533, was produced in a cell-free protein synthesis reaction using E.coli extract [19,20,26]. Analysis of the purified CoV-2 RBD protein yielded a single protein band with an apparent molecular weight of 23 kDa (Fig. 2C). The purified SARS-CoV-2 RBD was eluted as a single peak by analytical size-exclusion chromatography with >95% monomer content (Fig. 2C). Bacterial endotoxin contamination was determined to be <0.1 EU/mg by Charles River Endosafe LAL cartridge system.

• Download figure
• Open in new tab

Figure 2. RBD and IgY preparation.

(A) Workflow of the study. IgY preparation for intranasal drops as antiviral prophylaxis. (B) Cell-free expressed RBD derived from the Spike protein on the viral envelope of SARS-CoV-2. (C) Characterization of the recombinant protein RBD by ELISA and HPLC. (D) Determination of the affinity of the cell-free expressed RBD (amino acids 328-533) and mammalian-expressed full-length S1 to the hACE2 using Biacore.

Integrity of the cell-free (non-glycosylated) SARS-CoV-2 RBD was then verified by kinetic binding to the hACE2 receptor. Binding kinetics and affinity were similar to a mammalian expressed and glycosylated S1 fragment (Fig. 2D) and were consistent with previously described binding affinities, suggesting the RBD expressed cell-free was properly folded and bioactive.

Hen immunization with SARS-CoV-2 RBD and IgY characterization in vitro

Cell-free expressed RBD (Fig. 2B; 50 µg in simple oil emulsion) was injected into 9 SPF hens (46-weeks old) and IgY was extracted from egg yolks using a water-based method 2 weeks after the second immunization and thereafter. The IgY preparation was subjected to protein and Western blot analyses (Fig. 3A). The IgY preparations were >95% pure; a quantitative Western blot analysis demonstrated that this preparation contained less than 2% ovalbumin by weight (Fig. 3A). Chromatography of the IgY preparations on size-exclusion HPLC identified 5 peaks (Fig. 3B); SDS-PAGE and Western blot analysis of the peaks collected between 17 and 30 minutes confirmed that these peaks all contain IgY. The anti-SARS-CoV-2 RBD IgY antibodies recognized both the immunogen, cell-free expressed RBD, and the mammalian-expressed full- length and glycosylated S1 protein (Fig. 3C). One egg yolk of the SPF hens provided about 500 mg of purified IgY and each of >10 independent batches of IgY, purified from 100 eggs, each yielded an average of 47 ± 13 g (SD) of purified IgY (Fig. 3D). There was limited variability in the affinity of the various IgY batches for the S glycosylated protein as judged by ELISA (Fig. 3D; average titer against full-length S1 was 1:18,000). Furthermore, there was almost no difference in titer of individual hens towards the full-length glycosylated S protein, suggesting minimal variability between hens (Fig. 3E, F). Over 11 months, IgY was collected in batches of 100 eggs per preparation with a similar yield of IgY per preparation and a similar response; interruption of immunization for 3 months did not result in a drop in titer (Fig. 3F, right panel). Approximately 300 µg/mL IgY provided 50% neutralization of the index virus in culture (Fig. 3H).

• Download figure
• Open in new tab

Figure 3. IgY purification and characterization.

(A) Western blot analysis of the IgY preparation. (B) HPLC profile of the IgY preparation. (C) Western blot analysis of anti-SARS- CoV-2 IgY against RBD fragment and full S1 recombinant protein. (D) IgY yield for various batches derived from 100 eggs each. (E) Western blot data of different lots of anti-SARS-CoV-2 RBD IgY (Y0120-Y0199). Pools of 100 eggs laid by 9 hens over 2 weeks were used for each pool of IgY preparation between May 2020 and March 2021. IgY lot samples were diluted 1:500 followed by a 1:3000 dilution of rabbit anti-IgY HRP conjugate. First left lane shows the Coomassie stain of the same gels. (F) Time-dependent ELISA titers of sera from 3 individual hens following continual immunization (left); arrows indicate immunization timing. Time- dependent ELISA titer of 3 hens after immunization was stopped for up to 12 weeks (right). (H) Neutralization of pseudovirus SARS-CoV-2 by various lots of anti-SARS-CoV-2 RBD IgY (conducted at RetroVirox). (I) Neutralization of live index SARS-CoV-2 virus by anti-SARS- CoV-2 RBD IgY (Y0180, conducted at USAMRIID).

Neutralization of SARS-CoV-2 index strain and variants of interest and concern with anti-SARS-CoV-2 RBD IgY

Pseudoviruses are synthetic chimeras that consist of a surrogate viral core derived from a parent virus and an envelope glycoprotein derived from a heterologous virus [26]. Viral neutralization assays in culture (RetroVirox) used non-replicative VSV pseudoviruses carrying a firefly luciferase reporter gene and expressing S of SARS-CoV-2 on the surface of the virion (VSV-S). The neutralization assay was performed with HEK 293T-hACE2, a human embryonic kidney cell line overexpressing hACE2, the receptor of the SARS-CoV-2 virus. First, 5 batches of RBD IgY preparations were tested. The neutralization activity of the purified IgY, defined as the concentration inhibiting 50% of the viruses (IC50) was ∼170 µg/mL (Fig. 3G). Importantly, ∼10- fold higher neutralization activity towards the index SARS-CoV-2 virus was observed when using a live index virus (Fig. 3H).

Because at least 13 common variants of SARS-CoV-2 with amino acid mutations in the RBD had emerged since December 2020 [27–29] (Fig. 4A), we tested the activity of the anti- SARS-CoV-2 IgY against several variants (including Beta, Delta, and Omicron; Fig. 4A, B) and D614G, an amino acid substitution outside the RBD that is now found in most variants. Beta, Delta, and Omicron were classified as variants of concern, associated with increased transmissibility or detrimental change in COVID-19 epidemiology, or an increase in virulence or change in clinical disease presentation.

• Download figure
• Open in new tab

Figure 4. Common variants of SARS-CoV-2 and anti-SARS-CoV-2 IgY interaction with them.

(A) A scheme depicting locations of mutated amino acids in Alpha through Mu variants of SARS-CoV-2, focusing on the RBD domain only. Each color bar indicates the amino acid in the index virus that was mutated in the variant. (B) Spike protein of SARS-CoV-2 Alpha, Beta, Delta, and Omicron are shown from left to right. Molecular Operating Environment was used to create the figure [31]. The location of mutations in the structure of the S protein trimer of SARS-CoV-2 (PDB ID: 7A98) for 4 of the common variants are indicated in red and glycosylation sites are indicated in pink throughout the S protein. Blue ribbon indicates RBD (amino acids 328-533) and the orange ribbon indicates receptor binding motif (amino acids 437- 508). (C) Binding of anti-SARS-CoV-2 RBD IgY to recombinant S1 full length (FL) of the index virus, the RBD of the Alpha and Beta variants, and the immunizing RBD of the index virus by ELISA. (D) Binding of anti-SARS-CoV-2 RBD IgY to the index virus and Omicron variant (B.1.1.529) RBD domain using ELISA. (E) Neutralization of pseudovirus (VSV-S) SARS-CoV-2 carrying S protein of index pseudovirus, Alpha, or Beta variants by anti-SARS-CoV-2 RBD IgY. (F) Neutralization of pseudoviruses listed in (E) by Human anti-SARS-CoV-2 RBD. (G) Neutralization of live index or Delta viruses by anti-SARS-CoV-2 IgY against the RBD. (H) Neutralization of live D614G vs. Delta variants by human serum of immunized individual or by anti-SARS CoV-2 IgY. Microscopic evaluation of monolayers of Vero E6 cells after 96 hours infection with the indicated authentic (live) SARS-CoV-2 variant. Images from infected cells are shown after 4 days of infection with SARS-CoV-2 variants in the absence or presence of test items. Top three panels: Infection in the presence of MEX-BC2/2020 and bottom three panels: infection with the Delta variant each in the presence of vehicle alone, serum of a person immunized twice with the Moderna (mRNA-1273) vaccine or anti-SARS CoV-2 RBD IgY, as indicated, all at the indicated concentration (neutralization experiments in panels E-H were conducted by RetroVirox using pseudovirus or live virus, as indicated). Except when indicated, the studies were done over several months; therefore, the absolute titers in the ELISA and neutralization studies were not identical. However, each experiment included the same positive control; index RBD for ELISA and index virus for neutralization assays.

First, IgY antibody ELISA titer against Beta RBD was compared with the RBD of the index SARS-CoV-2 virus as well as the most common Alpha variant. ELISA with recombinant full-length S protein or the RBD of the 3 mutants as well as the immunizing RBD fragment of the index virus yielded a virtually identical titer (Fig. 4C). Although the Omicron variant still uses the hACE2 receptor to infect human cells [10, 30], the RBD contains a total of 15 mutations compared to the index virus, 11 of which were not found in the previous variants (Fig. 4A, B).

Yet, the ELISA titer of IgY against the Omicron RBD was also equivalent or slightly better than that towards the RBD of the index virus (Fig. 4D).

Next, we tested the neutralization titer of anti-SARS-CoV-2 RBD IgY (lot Y0180) against the RBD of the index, Alpha, and Beta variants, thus including all the amino acid substitutions within the RBD also found in the RBD of Gamma, Zeta, Eta, Theta, Iota, and Mu variants and 1 of the 2 substitutions in the Kappa variant (Fig. 4A). The IC50 of the VSV-S pseudovirions for the index strain and Beta variant were virtually identical: 668 μg/mL for the index strain, 568 μg/mL for Beta (Fig. 4E), and 2-fold lower for Alpha (IC50 = 302 μg/mL; Fig. 4E). RetroVirox also provided data using plasma from a single Moderna-vaccinated individual for a titer comparison of neutralization with anti-SARS-CoV-2 RBD IgY, tested with 3 of the variants. In a side-by-side study, the IC50 generated with the human plasma from a recipient of the mRNA Moderna vaccine (2 doses; index SARS-CoV-2) showed the highest titer against the index virus, followed by a 2.8-fold drop in titer towards Alpha and a 6.7-fold lower titer for Beta (Fig. 4F).

The anti-SARS-CoV-2 IgY preparation was similarly effective against the Delta variant compared with the index strain (Fig. 4G). The assays show that Y0180 displays similar neutralizing activity against both isolates; IC50 values generated were 635 μg/mL (Delta) and 739 μg/mL (index virus). Plasma from a Moderna-vaccinated individual was also tested in parallel with both isolates. NT50 values generated with this plasma against the variants were 1:1274 (Delta pseudovirus) and 1:1091 (index pseudovirus). The neutralization activities of the antibody and control plasma against both variants were also confirmed by microscopy evaluating the virus-induced CPE in infected cell monolayers (Fig. 4H). The human serum had a similar degree of neutralization against the index pseudovirus and Delta (Fig. 4H) when tested at a dose that is three times higher than that required for 50% neutralization (1:640 in Fig. 4H, middle panels, vs. 1:2,000 in Figure 4F). In contrast, anti-SARS-CoV-2 IgY tested at 400 µg/mL (Fig. 4H, right panels), a dose below that required for 50% neutralization (∼650 µg/mL; Fig. 4G), was equally effective against both variants. Together, these data indicate that the spectrum of the polyclonal anti-SARS-CoV-2 RBD IgY displays sufficient diversity so that none of the common point mutations in the RBD associated with a greater transmission rate of the virus affected the neutralization efficacy of these most common SARS-CoV-2 variants of concern.

Efficacy study in a hamster model of COVID-19

We did not find in vivo efficacy of anti-SARS-CoV-2 RBD IgY in the Syrian golden hamster COVID-19 model against a challenge with a titer of 0.8 or 4 x 10⁶ of SARS-CoV-2 virus, likely because the amount of virus we employed was too high. Lung viral load after 3 days was comparable between the control treatment group and the anti-SARS-CoV-2 RBD IgY treatment group, but body weight loss was more severe in control animals (S1 Fig).

Rat toxicity and safety study

All 8-week-old Sprague Dawley rats (10 males and 10 females) in the 28-day GLP safety study (Fig. 5A) survived to scheduled euthanasia with no mortality, test article-related organ weight changes, or gross or microscopic findings (see Fig. 5B). There were also no differences between female and male groups in each treatment arm. The GLP-qualified assay detected no anti-SARS- CoV-2 RBD IgY in the sera of animals after 28 days of daily treatment with 4 mg anti-SARS- CoV-2 RBD IgY (lower limit of detection of 30 ng/mL).

• Download figure
• Open in new tab

Figure 5. Preclinical toxicity of 28-day treatment with anti-SARS-CoV-2 RBD IgY in rats.

(A) Study design. (B) Summary of findings. (C) Serum levels of 27 cytokines over time in rats treated with IgY (Tx) or vehicle/placebo (PL). Data are provided for Day 1 before treatment (D1H0); Day 1, 4 hours after the treatment (D1H4); 24 hours after the two treatments, 6 hours apart, at 24 hours after the first treatment (D1H24); 28 days of twice-daily treatments and 4 hours of the treatment of that day (D28H4); and 28 days of twice-daily treatments and 24 hours of the treatment of that day (D28H24). Red indicates a statistical difference with a false discovery rate (FDR) significant p-value (p < 0.05).

There was no evidence of significant systemic immune activation in the rats (20/group) treated as above by measuring changes in levels of 27 proinflammatory serum cytokines after anti-SARS-CoV-2 RBD IgY administration (Fig. 5C). When comparing posttreatment (Day 1 at 4 hours and Day 28 at 24 hours after twice-daily treatments) to pretreatment serum levels (Day 1, time 0; D1 H0), there were no changes for most of the cytokines (22 of the 27 tested) in both placebo- and IgY-treated groups at any time. Compared with D1 H0, we detected a transient, slight increase in interleukin-1 (IL-1) beta and monocyte chemoattractant protein-1 (MCP1) on Day 1, 4 hours after anti-SARS-CoV-2 RBD IgY administration. A similar trend that did not reach significance was also observed in the placebo group at the same time; increases in IL-1 beta and MCP1 were not seen at any other time. There was a significant increase in interferon- inducible protein 10 (IP10) on Day 1, 4 hours after the first treatment compared to D1 H0, observed in both treatment and placebo group. A significant decrease in D1 H24 in the placebo arm was observed only for RANTES (Fig. 5C). Nonetheless, none of these changes in cytokines were observed in the rats at other time points. Together, our data show that long-term twice-daily administration of 4 mg/mL IgY (or 16 mg/kg) up to 28 days in rats has excellent safety and tolerability with no evidence of systemic immune activation.

Human tissue cross-reactivity study

We determined potential cross-reactivity of the anti-SARS-CoV-2 RBD IgY protein to a full panel of human tissues (at least 3 donors per tissue; see S4 Table for a list of human tissues tested for reactivity). Anti-SARS-CoV-2 RBD IgY reactivity at two concentrations (20 and 10 µg/mL) was compared with control polyclonal chicken IgY antibodies (negative control), and with anti-human macroglobulin (positive control for staining). No specific binding was observed with the anti-SARS-CoV-2 RBD IgY to any of the human tissue panels examined, including human nasal cavity and lung (see Fig. 6).

• Download figure
• Open in new tab

Figure 6: Lack of cross-reactivity of anti-SARS-CoV-2 RBD IgY with human tissues.

Immunohistochemical testing of anti-SARS-CoV-2 RBD IgY (top row), control IgY (middle row; negative control), and anti-human macroglobulin antibodies (bottom row; positive control) with human nasal mucosa (left two panels) and human lungs (right two panels). Bars provide a magnification scale.

Phase 1 Clinical Trial Results

Forty-seven of 48 enrolled participants completed the study drug treatment period and planned study visits. One participant in the multiple-dose part was withdrawn from the study after receiving 3 doses (Day 1) of placebo due to a concurrent upper respiratory tract infection, judged to be unrelated to study drug by the investigator.