Gastrointestinal involvement attenuates COVID-19 severity and mortality

Clinical characteristics of discovery cohort

We initiated a large, multi-cohort study to determine the role of the GI tract in the pathogenesis of SARS-CoV-2 infection. Our initial, ‘discovery cohort’ comprised 925 patients who tested PCR positive for SARS-COV-2 at the Mount Sinai Hospital (MSH) in New York City between April 1, 2020 and April 15, 2020. Among these 925 patients, 634 cases met our inclusion criteria of hospital admission, age > 18 years and having a multiplexed cytokine panel performed during their admission (Supplementary Fig. 1). The basic demographics and clinical characteristics are summarized in Table 1. Patients were 64 ± 16 years old (range 23–99 years) with 369 (58%) of the patients being male. The cohort comprised 28% Hispanic, 25% African American, 22% White and the remainder Asian or other based on patient’s self-reported ethnicity. Comorbid illnesses included obesity (37%), hypertension (HTN) (36%) and diabetes mellitus (DM) (22%), similar to prior reports⁴⁰. Fifty-four (9%) patients had mild disease, 361 (57%) moderate, 158 (25%) severe and 61 (10%) had severe COVID-19 with end organ damage (EOD) (Table 2, disease severity defined in Methods and Supplementary Table 1). During hospitalization, 110 patients were admitted to the ICU (17%) and 151 patients (24%) died by the end of data collection (6/15/2020) (Table 2).

We analyzed diarrhea, nausea and vomiting at the time of hospital admission. Two hundred and ninety-nine patients (47%) reported any GI symptoms (nausea, vomiting and/or diarrhea) with diarrhea being the most common (245 patients, 39%), followed by nausea (157 patients, 25%), and then vomiting (82 patients, 13%) (Table 3). Patients with GI symptoms were significantly younger (average age 61 years) than those without GI symptoms (average age 67 years) (p< 0.0001) (Table 1). The distribution of race, ethnicity and co-morbid illnesses including obesity, HTN, DM and inflammatory bowel diseases (IBD) were comparable between those with GI symptoms and those without GI symptoms (Table 1).

COVID-19 severity was significantly reduced in patients with GI symptoms when compared to those without GI symptoms

In an effort to determine the association between GI symptoms and COVID-19 severity, we initially performed univariate analysis comparing the distribution of COVID-19 severities in patients with and without GI symptoms. Patients presenting with GI symptoms had less severe disease than patients without GI symptoms (p< 0.001 Chi-square test). Importantly, mortality was significantly lower in COVID-19 patients with GI symptoms (15.7%) than those without GI symptoms (31.0%; p< 0.0001 Fisher’s exact test) (Table 2, Fig. 1a). Furthermore, each individual GI symptom (nausea, vomiting and diarrhea) was associated with less severe disease (p< 0.02 Fisher’s exact test) and lower mortality (p< 0.001 Fisher’s exact test) (Fig. 1a). These findings were further emphasized by Kaplan-Meier estimates of survival over short-term follow-up of 25 days (p< 0.001 log-rank test) (Fig. 1b, Supplementary Fig. 2a). Consistent with prior reports^35,40,41 older age and higher disease severity were associated with higher mortality in the discovery cohort (Table 4), providing validity to our findings.

• Download figure
• Open in new tab

Fig. 1: GI symptoms in COVID-19 patients associated with reduced severity and mortality

a, Inverse association between GI symptoms (nausea, vomiting, diarrhea, and any symptoms) with severity and mortality in the discovery cohort. For each GI symptom (columns), the percentage of patients allocated (as indicated by % verlap) to severity and mortality status (rows) is displayed. P-values from Fisher-Exact test for the association between GI symptoms and severity (less than 0.001) mortality (less than 0.05). b, Kaplan-Meier (KM) curves for survival stratified by any GI Symptoms (left panel) and diarrhea (right panel) for patients in the Discovery Cohort. P-values from log-rank test and 95% confidence intervals of KM curves are shown. Below each KM curve, the number of patients at risk are reported for the respective time points. c, Significant variables associated with mortality and severity multivariate logistic regression. Significant associations were derived via 95% confidence intervals based on 1000 bootstrap iterations. Negative associations are splayed in blue; while positive associations in red. Severity and mortality were modeled as function of each individual GI symptom (i.e., nausea, vomiting and diarrhea) and any GI symptoms, and covariates including age, gender, BMI, ypertension, diabetes, lung and heart diseases. This plot shows the sign of ssociation of each GI symptom and the covariates which were found significant cross different GI symptoms models. d, Confidence intervals of odds ratio (95%) of symptoms based on 1000 bootstrap iterations based on multivariate logistic regression for severity (blue) and mortality (red). e, Validation based on the external cohort. Confidence intervals of odds ratio (95%) of diarrhea covariate based on 1000 otstrap iterations to capture mortality, ICU and composite outcome of ICU mission or death. Results are based on multivariate models after accounting for confounders such as BMI, age, gender, lung disease, heart diseases and ypertension. f, Validation and prediction model based on the internal cohort. Boxplot of AUC over 1000 bootstrap iterations to predict Mortality and Severity status in the validation cohort (top panel). Confidence intervals of the reduction in AUC (95%) based on 1000 bootstrap iterations for the model “Age + BMI + Any GI Symptoms” after removing age (blue), GI symptoms (red) and BMI (dark-green).

Next, we decided to account for multiple comorbidities in determining the impact of GI symptoms on COVID-19 outcomes. Herein, we adjusted for age, body mass index (BMI), gender, race, diabetes, HTN, chronic lung disease and heart disease in a multivariate model to determine the impact of any GI symptoms and each of the individual GI symptoms (nausea, vomiting or diarrhea) on disease outcomes. In the multivariable models, any GI symptoms, diarrhea, nausea, and vomiting, were inversely associated with disease severity and mortality, while age and BMI were positively associated with these outcomes. African-American race was inversely associated with disease severity but not mortality (Fig. 1c, Supplementary Fig. 2b, Supplementary Table 2). Patients who presented with GI symptoms had 50% reduced odds of having severe disease (odds ratio of 0.56) and death from COVID-19 (odds ratio 0.54), compared to the patients who presented without GI symptoms (Fig. 1d, Supplementary Table 2).

An external validation cohort further confirms decreased mortality in COVID-19 patients with GI symptoms

Next, we sought an external validation cohort, distinct from the MSH discovery cohort, and studied well-characterized patients (n = 287) from Milan, Italy, to determine the impact of GI symptoms on COVID-19 associated outcomes. In this cohort, GI symptoms on admission were characterized as presence (n = 80, 27.9%) or absence of diarrhea on admission (Table 5). Consistent with the discovery cohort, patients with diarrhea on admission were significantly younger (60.6 ± 13.9 vs 65.5 ± 13.3 for patients without diarrhea, p = 0.0056) and had significantly lower mortality (10.0% in patients with diarrhea vs 23.7% in patients without diarrhea, p = 0.008). Additionally, patients with diarrhea had lower composite outcome of mortality or ICU admission compared to those without diarrhea (20% vs 40%, p = 0.0014) (Table 5). Distinct from the discovery cohort, the proportion of male patients was lower in those patients with diarrhea (57.5%) compared to those without diarrhea on admission (72%) (p = 0.0238) (Table 5). Next, the association between diarrhea and mortality was evaluated by multivariate logistic regression adjusting for age, gender, BMI, diabetes, chronic heart and lung disease and other confounders. Even after adjusting for these covariates, the presence of diarrhea on admission was found to be significantly inversely associated with mortality with a median odds ratio of 0.33 over 1000 bootstrap iterations (Fig. 1e).

Presence of GI symptoms can be used to predict reduced disease severity and mortality in patients with COVID-19 in a second validation cohort

After observing significantly reduced mortality in COVID-19 patients with GI symptoms in our discovery and external validation cohort, we developed a predictive model based on the discovery cohort and applied it to a distinct internal validation cohort comprising of 242 well-characterized patients with COVID-19, admitted between April 16, 2020 and April 30, 2020 to MSH. The inclusion of ‘any GI symptoms’ to a model consisting of age and BMI at baseline, improved the ability to predict severity and mortality with a median area under the curve (AUC) of 0.59 (age + BMI) vs. 0.64 (age + BMI + any GI symptoms) for disease severity and 0.70 (age + BMI) vs. 0.73 (age + BMI + any GI symptoms) for mortality (Fig. 1f, Supplementary Table 3). In addition, the effect of GI symptoms, age and BMI on the AUC was evaluated by excluding each variable one at a time from the model and calculating the consequent reduction in AUC. The exclusion of GI symptoms resulted in a significant reduction in AUC with a median value of 0.054 for disease severity and 0.03 for mortality. Notably, the effect of GI symptoms on the AUC was more dramatic than that of age (AUC reduction of 0.054 versus 0.025) for disease severity (Fig. 1f, Supplementary Table 3).

COVID-19 patients with GI symptoms have reduced levels of circulating cytokines associated with inflammation and tissue damage

To gain mechanistic insights into significantly reduced COVID-19 severity and mortality across these three large cohorts, we began by analyzing systemic biomarkers, comparing patients with and without GI symptoms admitted to MSH (discovery and internal validation cohorts). Initially, we examined, a set of 4 cytokines, IL-6, IL-8, TNF-α, and IL-1β, measured on admission in all the patients as part of routine clinical care. IL-6, and IL-8 levels, known to be associated with poor survival³⁵ were found to be significantly reduced in circulation of patients with GI symptoms (FDR 10%) (Supplementary Fig. 3, Supplementary Table 4).

Next, to facilitate high dimensional analyses of potential immunological differences between patients with and without GI symptoms, we performed a validated, multiplexed proteomic assay (O-link), simultaneously quantifying 92 protein analytes in 238 patients (from among the discovery and internal validation cohorts; GI symptoms (n = 104), no GI symptoms (n = 134)) where serum samples were available for analyses. Unsupervised consensus clustering of these 92 analytes revealed six groups of analytes with similar expression patterns across all COVID-19 patients (Fig. 2a, Supplementary Table 5). Notably, analytes in clusters 5 and 6 displayed less correlation in patients with GI symptoms compared to those without GI symptoms (Fig. 2a, Supplementary Fig. 4). Next, we interrogated biological pathways over-represented in each cluster of soluble analytes. We found that the “KEGG Jak/Stat Signaling Pathway” was significantly enriched in Cluster 5; while the “Hallmark Inflammatory Response” pathway was significantly enriched in Cluster 4 (Fisher’s exact test 10% FDR). These pathways were downregulated in patients displaying diarrhea symptoms based on pathway level signatures (p< 0.05 from t-test) (Fig. 2b); suggesting a reduced inflammatory response in patients affected by GI symptoms. In addition, we found that clusters 1, 2, 3, 5 and 6 were significantly downregulated in patients with GI symptoms compared to those without (FDR 15%) (Fig. 2c). This downregulation seemed to be driven mostly by diarrhea since the same clusters 1, 2, 3, 5 and 6 were significantly downregulated with FDR correction at 10% in patients who presented with diarrhea compared to those without symptoms. The lack of signal registered for nausea and vomiting might be due to reduced statistical power given by the smaller number of samples displaying vomiting (n = 29) or nausea (n = 54) symptoms.

• Download figure
• Open in new tab

Fig. 2: COVID-19 patients with GI symptoms have reduced levels of circulating inflammatory cytokines

a, Correlation matrix (Pearson’s) for 92 markers contained in multiplexed proteomic platform (Olink) across patients with any GI symptoms (top left panel) compared with no GI symptoms (top right panel) and patients with diarrhea (bottom left panel) compared th patients without diarrhea (bottom right panel). Cluster assignment derived based on consensus clustering is reported on the top of the heatmap. b, Boxplot of “Hallmark Inflammatory Response” and “KEGG JAK/STAT Signaling pathway” z-scores stratified by GI symptoms. P-values from unpaired t-tests are reported. “Hallmark Immune Response” and “Hallmark JAK/STAT Signaling” pathways were found significantly enriched at 10% FDR in Cluster 4 and Cluster 5, respectively. c, Association between proteomic clusters GI symptoms. This association was derived by comparing clusters signatures tween asymptomatic and symptomatic groups via t-test. Associations significant at 10% (dark blue) and 15% (light blue) FDR are reported. d, Analytes associated with GI symptoms at 10% FDR based on unpaired t-test. The intensity of the color is proportional to the -log10 p-value. Negative associations are displayed in blue; while positive ssociations in red. On the right side of the heatmap, the cluster assignment for each marker is reported. c, Boxplot of select differentially expressed markers stratified by GI symptoms. P-values from unpaired t-tests are reported.

When looking at each of the 92 analytes individually, key inflammatory cytokines and chemokines were significantly downregulated (IL-8, TGF-a, IL-17C, IL-15RA, IL-10RB, MMP10, TNFRSF9, OPG, IL-6, LIF, GDNF, IL-17A, ARTN and CCL28). On the other hand, TNF-Related Apoptosis Inducing Ligand (TRAIL), a cytokine with immune regulatory properties^42,43 and IL-7, a cytokine associated with T cell development⁴⁴ were significantly upregulated in patients with GI symptoms compared to those without (t-test FDR 10%) (Fig. 2d,e, Supplementary Table 6). When looking at each individual GI symptom, diarrhea had the most significantly differential analytes. As a caveat, this difference between diarrhea, nausea and vomiting might be due to reduced statistical power given that fewer patients presented with nausea and vomiting than those who presented with diarrhea. Consistent with GI symptoms as a group, IL-7 was significantly increased, in addition, MCP-2 was significantly increased in patients presenting with diarrhea.

We also quantified total anti-spike protein IgA, IgG and IgM antibodies and compared patients with and without GI symptoms and patients with and without diarrhea. There were no significant differences between the groups (Supplementary Fig. 5)

Thus, overall, GI symptoms are associated with significantly reduced levels of key inflammatory cytokines like IL-6, IL-8, IL-17 and CCL28 that are known to be associated with poor COVID-19 outcomes.

The GI tract was endoscopically uninflamed in all patients

Next, we sought to obtain GI tissue-level mechanistic insights regarding disease pathogenesis. To this end, we enrolled 18 cases with COVID-19 and 10 SARS-CoV-2 uninfected controls who underwent upper GI endoscopy (SARS-CoV-2 infected n = 16, uninfected n = 8), colonoscopy (SARS-CoV-2 infected n = 1, uninfected n = 1) or both upper endoscopy and colonoscopy (SARS-CoV-2 infected n = 1, uninfected n = 1) (Table 6, Supplementary Table 7). Patient 10 was initially suspected to have COVID-19 but was excluded after multiple negative SARS-CoV-2 nasopharyngeal (NP) PCR tests and negative COVID-19 antibody tests. The remaining 17 cases were classified as asymptomatic / mild / moderate (n = 10) or severe (n = 7) disease according to the criteria detailed in Supplementary Table 1. While we endeavored to examine patients as early in disease course as was possible, given the aerosolizing nature of endoscopic procedures (potentially exposing endoscopic staff to SARS-CoV-2), as well as challenges inherent in endoscopic biopsies of acutely ill COVID-19 patients, a majority of patients were examined in the early convalescent phase of COVID-19 disease. Specifically, GI biopsies were performed after 27.5 ± 13.8 days from the onset of COVID-19 symptoms (or first SARS-CoV-2 PCR if asymptomatic) and 17.3 ± 17.5 days from the last positive NP swab (if patient had a positive NP swab after the procedure, it was considered to be 0 days from last PCR positive) (Fig. 3a). COVID-19 symptoms on presentation and treatment regimens were diverse as detailed in Supplementary Table 8. Sample allocation for different assays is detailed in Supplementary Fig. 9.

• Download figure
• Open in new tab

Fig. 3: Clinical timing and histologic and endoscopic features of COVID-19 in the small intestine.

a, Timing of of endoscopic evaluation with respect to COVID-19 course. b, Representative scopic views of the duodenum in COVID-19+ (left) and control (right) subjects. c, signs of inflammation detected in duodenal biopsies of COIVD-19 patients neutrophils (arrow) and increased intraepithelial lymphocytes (*). d, Histologically duodenal tissue in a COVID-19 patient. Scale bar; 100 µm.

The GI mucosa was endoscopically uninflamed in all subjects regardless of the severity of illness, with no evidence of loss of vascularity, edema, friability, erosions or ulcerations (Fig. 3b), except for one post-intestinal transplant case where inflammation was attributed to transplant rejection. Histopathological examination revealed a mild increase in intraepithelial lymphocytes (IELs) in 8 cases and a scant neutrophilic infiltrate in 7 cases (Fig. 3c, Supplementary Fig. 6, Supplementary Table 9). Notably, the biopsies were reported as histologically normal in 3 cases (Fig. 3d, Supplementary Table 9). Histopathological details of pre-pandemic (non-COVID-19) controls are provided in Supplementary Table 10.

Small bowel enterocytes have robust expression of Angiotensin converting enzyme-2 (ACE2) and harbor SARS-CoV-2 antigens

Early events in the pathogenesis of SARS-CoV-2 infection include attachment of the receptor binding domain of the viral spike (S) protein to epithelial ACE2^14-17. Using immunofluorescence (IF) microscopy, we observed robust and extensive expression of ACE2 on the small intestinal brush border in both COVID-19 cases and controls (Fig. 4a-h). Additionally, we detected SARS-CoV-2 nucleocapsid protein in small intestinal enterocytes of COVID-19 patients (Fig. 4i,n, Supplementary Fig. 7), but not controls (Fig. 4m,r, Supplementary Fig. 8), indicative of virus infection in these cells. Remarkably, when present, the distribution of viral antigens was patchy in the upper small intestines (duodenum; Fig. 4i-l), but diffuse in the lower small intestines (ileum; Fig. 4n-q). Positive staining was exclusively seen in the epithelium irrespective of intestinal location. Overall, of the 11 COVID-19 patients where IF staining was performed, 10 showed viral antigen on IF microscopy in at least one intestinal segment (duodenum or ileum) (Supplementary Table 9). Interestingly, the presence of viral antigens on IF did not correlate with the presence of histologic abnormalities. As negative controls, 5 duodenal biopsies and 6 ileal biopsies from 10 patients collected prior to the pandemic (Supplementary Table 10), showed no evidence of viral antigens on immunostaining (Fig. 4m,r, Supplementary Fig. 8).

• Download figure
• Open in new tab

Fig. 4: SARS-CoV-2 viral particles and protein are detectable in intestinal tissue of COVID-19 patients.

(a-h) Immunofluorescent staining of duodenal (a,b) and ileal (c,d) biopsies of COVID-patients (b,d) and controls (a,c) with ACE2 (green), EPCAM(red) and DAPI (blue) cluding isotype (e,g) and no primary (f,h) controls.

Immunofluorescent staining of duodenal (i-m) and ileal (n-q) biopsies from COVID-patients (i-l, n-q) and controls (m,r) with SARS-CoV-2 nucleocapsid (green), EPCAM (red) and DAPI (blue) including isotype (k,p) and no primary (j,q) controls. (s-u), Electron microscopy of duodenal biopsies (s, t) and an ileal biopsy (u) from COVID-19 patients showing viral particles (arrows). Scale bars; 100 µm (a-r), 0.5 µm (s,u), 0.1 µm (t).

Ultrastructural analyses of GI tissues reveal viral particles in small intestinal enterocytes

Transmission electron microscopy of intestinal biopsy tissues revealed the presence of 70–110 nm viral particles in the enterocytes of the duodenum and ileum (Fig. 4s-u). Pleomorphic, spherical structures, morphologically consistent with viral particles were observed in conjunction with small vesicles within enterocytes along the basolateral surface of the enterocytes (Fig. 4s) and blebbing off of the enterocyte apex (Fig. 4u). Particles with distinct, stalk-like projections (corona) were seen within the enterocyte cytoplasm (Fig. 4t). Overall, of the 13 patient samples processed for electron microscopy studies, 6 showed viral-like particles on ultrastructural analyses (Supplementary Table 9).

Infectious virions could not be isolated from the GI tissues of COVID-19 patients

Several attempts were made to assess for the presence of potentially infectious virions in the intestines of COVID-19 patients. Supernatants of homogenized intestinal tissues were inoculated on confluent Vero E6 cells and incubated at 37°C for 7 days. Brightfield microscopy showed no apparent cytopathic effects (CPE). In addition, cell culture supernatants did not reveal the presence of viral RNA by quantitative RT-PCR (qRT-PCR) and plaque assays. Experiments showed no plaque formation in Vero E6 cells after staining with 2% crystal violet solution.

RT-qPCR was performed in whole biopsy tissue after RNA isolation in both COVID-19+ patients and controls. Results showed that Ct values of COVID-19+ patients were ≥34, while RNA sequencing (RNA-Seq) data detected SARS-CoV-2 reads only in the one ileal sample tested but in none of the 12 duodenal biopsies. Altogether these data suggest that SARS-CoV-2 was present at low copy numbers in the GI tract of these early-convalescent COVID-19 cases.

GI lamina propria pro-inflammatory dendritic cells are depleted in COVID-19 patients

Next, we performed mass cytometry (CyTOF) based immunophenotypic analyses on the GI tissues of 13 and peripheral blood of 10 COVID-19 cases and 10 controls (Table 6, Supplementary Table 7, Supplementary Fig. 9). GI tissues were divided into lamina propria (LP) and epithelial compartment (EC) fractions and analyzed separately. Immune populations were clustered on the basis of cell-specific markers for both the LP and EC (Fig. 5a,c,g). While the overall distribution of canonical immune cell subsets in the GI LP were comparable between COVID-19 and control patients (Fig. 5a,b), few immune populations showed differences as detailed below. Additionally, no clear differences in the LP could be discerned between patients with asymptomatic/mild/moderate disease and those with severe disease (Fig. 5b, Supplementary Table 12a).

• Download figure
• Open in new tab

Fig. 5: Identification of immune cell signatures in intestinal biopsies and blood COVID-19 patients and controls based on mass cytometry.

a, Uniform Manifold Approximation and Projection (UMAP) presentation of the eight clusters immune populations based on 38 markers in lamina propria. b, UMAP presentation of defined by COVID-19 (Red) vs Controls (Blue) and clusters defined by cohort where are indicated in blue, severe COVID-19 patients indicated in red and symptomatic/mild/moderate COVID-19 patients are indicated in green in lamina propria. heatmap shows the different immune populations based on specific cell type markers propria of COVID-19 patients and controls. d, The histograms shows the decrease expression of CD206 and CD123 in dendritic cell populations of COVID-19 patients compared to the controls (blue). e, Unsupervised analyses of immune cells: The bar show the relative frequencies of different myeloid and lymphocytic immune populations namely CD206+ cDC2 and plasmacytoid DCs in lamina propria of controls (blue) and –19 patients (red).. f, Supervised analyses: The bar graphs depict alterations in PD-38+ (exhausted) CD4+ and CD8+ T cell subsets in lamina propria of controls (blue) and COVID-19 patients (red). g, Uniform manifold approximation and projection (UMAP) resentation of the eight clusters of immune populations based on 38 markers in epithelial compartment of small intestinal biopsies. h, Unsupervised analyses of immune cells: The plots show the relative frequencies of CD206+ cDC2 dendritic cells and CD4- CD8- T the intraepithelial compartment of controls (blue) and COVID-19 patients (red). i, Supervised analyses on PBMCs indicating immune cell changes in blood: The bar graphs alterations in PD-1+ CD38+ (exhausted) CD4+ and CD8+ T cell subsets in blood of(blue) and COVID-19 patients (red).

Open red circles denote patients with asymptomatic/mild/moderate disease while filled red denote patients with severe COVID-19.

In the LP, among myeloid cells, CD206⁺CD1c⁺“inflammatory” cDC2 (conventional DCs)⁴⁵ were reduced in COVID-19 cases compared to controls (0.4-fold decrease, p = 0.01). Additionally, plasmacytoid DCs (pDCs) were reduced in COVID-19 cases (0.5 fold decrease, p = 0.07) (Fig. 5d,e), analogous to changes described in the peripheral blood of COVID-19 patients³⁶. Among other LP populations, effector (PD-1⁺CD38⁺) CD4⁺ and CD8⁺ T cells were significantly increased in COVID-19 cases compared to the controls (Fig. 5f), while CD8⁺CD103⁺ T cells (tissue resident memory subset) trended higher in COVID-19 cases compared to controls (1.7-fold increase, p = 0.06) (Supplementary Fig. 10a). Neutrophils (3-fold), eosinophils (1.9-fold), CD4⁻CD8⁻T cells (3.5-fold) and CD4⁺CD103⁺ T cells (1.8-fold) were increased in COVID-19 cases, but these differences were not statistically significant possibly due to the sample size. We also observed a trend of non-significantly decreased regulatory CD4⁺ T (T_REG) cells (0.6-fold decrease) and increased IgM⁺ plasma cells (2.3-fold increase) in the LP of infected cases vs controls (Supplementary Fig. 10a). The distribution of naïve and memory CD4⁺ and CD8⁺ T cells was altered in COVID-19 patients, with a reduction of naïve CD4⁺ T cells and EMRA (effector memory re-expressing RA) CD8⁺ T cells in LP of COVID-19 patients (Supplementary Fig. 10b), but this difference did not reach statistical significance.

Similar to the LP, the EC showed a reduction of CD206⁺ cDC2 in COVID-19 cases compared to controls (0.4-fold decrease, p = 0.05), while the CD4⁻CD8⁻ subset of IELs was significantly increased (1.6-fold-increase, p = 0.03) (Fig. 5h). CD8⁺ T cells, the dominant IEL population, showed an increase (2.6-fold) in COVID-19 cases compared to controls but the difference did not reach statistical significance (p = 0.4) (Supplementary Table 12a), likely owing to inter-patient variability, also observed by light microscopy. A subset of CD8⁺ IELs, CD8⁺CD69⁺ T cells, showed a non-significant increase in COVID-19 cases vs controls (3.9-fold, p = 0.2), while plasma cells were comparable between the cases and controls (Supplementary Fig. 11 a,b,c).

In the peripheral blood, cell type assignments were carried out using specific cell surface markers (Supplementary Fig. 12a). We observed that effector (PD-1⁺CD38⁺) T cells (for both CD4⁺ and CD8⁺ T lymphocytes) were significantly increased in PBMCs of SARS-CoV-2 infected individuals (Fig. 5i). CD14⁻CD16⁺ inflammatory monocytes trended lower in COVID-19 cases compared to controls (0.4-fold decrease, p = 0.09). In contrast, CD14⁺CD16⁻ “classical” monocytes were comparable in COVID-19 cases and controls (p = 0.3) (Supplementary Fig. 12b). Additionally, a non-significant increase in IgG⁺ plasma cells (7.2-fold, p = 0.13) and a non-significant decrease in T_REG (0.8-fold, p = 0.2) were observed in COVID-19 cases (Supplementary Fig. 12c,d, Supplementary Table 12b). Finally, a significant increase in activated (CD29⁺CD38⁺) CD4+ T cells was noted in the peripheral blood of COVID-19 cases compared to controls (Supplementary Fig. 13a) and a non-significant increase of these activated T cells in the LP of COVID-19 patients (Supplementary Fig. 13b). Details of all immune population changes in the GI LP, GI EC and in circulation are provided in Supplementary Table 12a and 12b.

Altogether, similar to published data from the peripheral blood of COVID-19 patients³⁶, intestinal tissues from COVID-19 cases showed reduced pro-inflammatory DCs and pDCs but increased effector T cells compared to controls.

GI LP pro-inflammatory pathways are downregulated in COVID-19 patients

To further probe the molecular response of the GI tract following SARS-CoV-2 infection, we performed RNA-Seq on EC and LP cellular fractions separately in 13 COVID-19 patients and 8 controls. Samples derived from the EC and LP clustered separately on the basis of their top transcriptional signatures, demonstrating distinctness of the two compartments within the GI tract (Supplementary Fig. 14, Supplementary Data). Accordingly, comparisons between COVID-19 cases and controls were performed separately for each tissue, and 1063 differentially expressed genes (DEG) were identified out of total 11419 genes detected (Fig. 6a, Supplementary Data). The majority of DEGs were detected in the LP (1061, false discovery rate [FDR] £ 0.05), compared to 12 DEGs in the EC that largely overlapped with the LP (Fig. 6a). Both LP and EC showed upregulation of genes involved in immunomodulation, including the anti-microbial peptide LCN2, and the metallothioneins MT1E, MT1F, MT1H, MT1M, MT1X, MT2A and TMEM107. In addition, heat shock proteins, HSPA1A and HASPA1B, were downregulated in both tissues. Pathway enrichment analysis of DEGs ranked by significance revealed several KEGG pathways that were depleted in COVID-19 patients compared to controls (Fig. 6b). Downregulation of pathways linked to T_H17 cell differentiation and inflammatory bowel diseases (IBD) was characterized by the depletion of RORA, IL4R, IFNG, IL18R1, IL1B, STAT4 and HLA-DRA. Pathways linked to antigen processing, T_H1 and T_H2 cell differentiation, and MAPK signaling were significantly downregulated in the LP from COVID-19 patients. In contrast, genes associated with metabolic functions, including amino acid metabolism (NOS2, SMS, ALDH2, GOT2), mineral absorption (MT1G, MT2A, MT1E), as well as mucin biosynthesis (GALNT7, GALNT3, GALNT8) were significantly upregulated in COVID-19 patients compared to controls (Fig. 6b).

• Download figure
• Open in new tab

Fig. 6: Transcriptional changes in intestinal biopsies from COVID-19 against non-infected controls.

a, Herarchical clustering of average expression changes for 1,063 genes (rows) with(red) or depleted (blue) expression (FDR ≤ 0.05) in the epithelial layer (EC) and propria (LP) sections of intestinal biopsies from COVID-19 patients. The panel on indicates significant genes for each tissue section in yellow. The color bar indicates verage log2 fold-change (FC). b, Top enriched pathways (KEGG) induced (red) or(blue) in LP. The dash line indicates the p ≤ 0.05 cutoff. Gene names for are cated for main pathways related to inflammation and cell type composition. The dash dicates the p ≤ 0.05 cutoff. c, Deconvolution of main intestinal (GI) cell types or depleted in the LP section of COVID-19 convalescent patients against controls. ference scRNA-seq cell type signatures were taken from Smillie et al 2019. (p ≤ 0.05, exact test). d, Average expression changes for dendritic cell markers in the LP sections. The yellow boxes indicate significant genes for each tissue section. The bar indicates the average log2 fold-change (FC). e, Hierarchical clustering of average xpression changes (columns) in the EC and LP sections for genes related to antiviral to SARS-CoV-2 in post-mortem lung tissue of COVID-19 patients as described by –Mello et al. 2020 (top panel) and for cytokines and chemokines (bottom panel). genes are indicated by the asterisks. The color bar indicates the average log2 change (FC). f, The gene expression levels for the top 10 significant chemokines and in the LP section of COVID-19 patients (13) and controls (8). *p < 0.05, **p < Open red circles denote patients with asymptomatic/mild/moderate disease while red circles denote patients with severe COVID-19.

We considered the possibility that the observed expression changes could imply alterations in relative cell type proportions (in addition to transcriptional alterations within cells). Therefore, we interrogated GI data derived from single-cell RNA-seq⁴⁶ for enrichment of cell type-specific gene expression signatures. Consistent with CyTOF data (Fig. 5 and Supplementary Table 12a and 12b), genes associated with DCs and eosinophils were reduced in COVID-19 patients compared to controls (Fig. 6c). Additionally, signatures related to the size of endothelial cell and mast cell pools were reduced, while genes linked to goblet cells, proliferating epithelial cells, enteroendocrine cells and epithelial stem cells were increased, possibly reflecting the sequelae of intestinal epithelial infection by SARS-CoV-2 and subsequent recovery (Fig. 6c).

Given the unexpected reduction in DC numbers in the GI tissues, we probed myeloid gene signatures further, and found significant downregulation of genes associated with pDC (DAPK1, IRF7, ICAM1 and GM2A), activated DCs (TNFAIP2, CD86, CD83), cDC1 (RELB, IRF8 and HLA-DRA) and cDC2 (CLEC7A and CLEC10A). Of note, we also found that LP genes associated with inflammatory DCs (monocyte-derived DCs, MoDCs) (TGFBI, TGFB1, STAB1, SDCBP, RNASET2, MSR1, MRC1, MERTK, DNASE1L3, CD163L1, C5AR1, SPI1, CSF1R, AOAH, ABCA) were significantly reduced (Fig. 6d), which was consistent with the reduced number of inflammatory DCs observed by CyTOF.

Finally, we looked at the average EC and LP expression of recently reported gene signatures linked to the antiviral response against SARS-CoV-2 from post-mortem lung tissue samples³⁰, and human intestinal organoids²⁹. Although we did not observe a substantial acute SARS-CoV-2 response, there was significant upregulation of LCN2 in both EC and LP, and OAS and GBP3 in the LP only. Notably, we did observe a trend towards induction of antiviral response genes in the EC, where expression of canonical antiviral genes such as IFI44L, IFIT1, IFITM3, IFI44, IFI6 and OAS3 was increased (Fig. 6e).

Next, using gene set enrichment analysis (GSEA), we rank ordered the EC DEGs according to effect size (logFC * −logPvalue) and tested for enrichment in the reported SARS-CoV-2 infected gene signatures²⁹ (Supplementary Fig. 15a). The genes upregulated in EC showed a significant enrichment in genes upregulated in the SARS-CoV-2 infected intestinal organoid gene datasets. We then carried out Hallmark pathway enrichment analyses on this ranked EC gene list and found that the top two processes associated with genes upregulated in EC were interferon alpha response (normalized enrichment score (NES) 1.91, FDR< 0.005) and interferon gamma response (NES = 1.8, FDR = 0.005) (Supplementary Fig. 15b). This enrichment is indicative of the host antiviral response against SARS-CoV-2 in human intestines of COVID-19 patients.

We then evaluated cytokines and chemokines in intestinal samples projecting our RNA-seq dataset with published data from the human bronchial epithelial cells infected with SARS-CoV-2³⁰. Remarkably, we found that the many of the inflammatory cytokines and chemokines such as IL-1b, IFNg, CCL24 and CXCL8 were downregulated in COVID-19 patients (Fig. 6e). The only chemokine showing significant increase was CCL15 which is reported to have structural properties of antimicrobial peptides and has a role in maintaining intestinal homeostasis⁴⁷ (Fig. 6e). Significantly, we also noted that the key inflammatory genes including IFNG, IL1B, CXCR4, TNFSF14, CXCL2, CSF-1, CXCL8, IL18R1, NRP1 and IL18BP were downregulated in intestinal LP of COVID-19 cases compared to the uninfected controls (Fig. 6f).

Together, these data reveal a dynamic remodeling of GI tissues by SARS-CoV-2, notable in the LP for a significant downregulation of pathways associated with inflammation and antigen presentation, yet activation of viral response signaling genes in the EC.

Clinical cohorts

SARS-CoV-2 testing

The SARS-CoV-2 PCR was run in the Clinical Microbiology laboratory as part of routine care on the Roche cobas platform. This platform performs selective amplification of 2 targets ORF-1 (Target 1) and the E-gene for pan-Sarbecovirus (Target 2) (detects SARS-CoV-2 as well as SARS or MERS viruses, but not routine seasonal Coronavirus). A positive result indicated that either both Target 1 and Target 2 were detected (majority of cases) or Target 1 alone was detected. A presumptive positive result indicates a negative Target 1 result and a positive Target 2 result which according to the manufacture can be a result of the following: “1) a sample at concentrations near or below the limit of detection of the test, 2) a mutation in the Target 1 target region in the oligo binding sites, or 3) infection with some other Sarbecovirus (e.g., SARS-CoV or some other Sarbecovirus previously unknown to infect humans), or 4) other factors.” Patients with a presumptive positive SARS-CoV-2 PCR were included in the analysis if they were treated clinically as having COVID-19.

Computational analyses

ELLA Cytokine panel

The ELLA platform is a method for rapid cytokine measurement using microfluidics ELISA assays. The assay measured TNF-α, IL-6, IL-8, and IL-1β, previously validated by the Mount Sinai Human Immune Monitoring Center (HIMC) using plasma from multiple myeloma patients and recently reported for large cohort of COVID-19 patients admitted to Mount Sinai Hospital³⁵.

Multiplexed proteomic assay (Olink)

For analysis of circulating cytokines, we used a multiplexed proteomic inflammation panel (Olink), which consists of 92 inflammation-related proteins quantified by an antibody-mediated proximity extension-based assay⁸⁹. Samples with normalized protein expression values below the limit-of-detection in >75% of samples were excluded from further analysis. For the remainder of analytes, any sample under the limit of detection was assigned a value of the limit-of-detection divided by the square root of 2. The log2 fold-change over the median healthy control protein expression was then calculated, and the Benjamini-Hochberg⁹⁰ procedure was used to adjust P values for multiple testing

Consensus Clustering of Olink Data

For this analysis, we considered 238 samples with GI symptoms annotation. Consensus clustering was performed based on the abundance of 92 cytokines across all 238 samples. Consensus clustering was performed using the R packages ConsensusClusterPlus⁹¹ based on z-score normalized data. Specifically, markers were partitioned into six clusters using the Kaplan

Meier (KM) algorithm, which was repeated 1000 times. Then, markers in each cluster were considered in order to derive cluster z-score signatures via package GSVA⁹². Based on these signatures, the association between different clusters and GI symptoms were derived via logistic regression with outcome corresponding to each GI symptom. Fig. 2c shows the signed FDR (-log10 scale). P-values were adjusted via Benjamini-Hochberg⁹⁰.

Defining associations between GI symptoms and Olink protein markers

Associations between GI symptoms and Olink proteomic data were derived using unpaired t-test comparing the symptomatic and asymptomatic groups. P-values were adjusted via Benjamini-Hochberg⁹⁰. Only associations passing a 10% FDR were reported as significant (Fig. 2d).

Defining associations between GI symptoms and ELLA cytokine markers

Unpaired t-test were used to compare individual cytokines quantified by the ELLA panel between GI symptomatic and asymptomatic groups. P-values were adjusted via Benjamini-Hochberg⁹⁰.

Biopsy collection and processing for Mass cytometry (CyTOF)

Endoscopic biopsies were obtained from COVID-19 patients and non-COVID-19 controls during clinically indicated endoscopic procedures. The biopsies were processed in biosafety level 3 (BSL-3) facility within 2 hours of collection.

Briefly, biopsies were transferred to 10 ml of ‘dissociation buffer’ (1M HEPES(Lonza), 5uM EDTA(Invitrogen), 10% FBS in HBSS buffer (Gibco). The tubes were kept in a shaker (180 rpm, 37°C) for 20 min and then gently vortexed for 10 seconds. Cell suspensions were collected after passing the biopsies through 100um cell strainers. A second round of EDTA dissociation was performed as detailed above. The cell suspension was centrifuged at 1800 rpm for 10 min to pellet the epithelial fraction and kept on ice. The ‘non-epithelial fraction’ of the tissue was transferred to fresh tubes containing a ‘digestion buffer’ (2% FBS, 0.005g Collagenase type IV per sample (Sigma), 100 ul DNAse-I(Sigma) in 10ml in RPMI). Tubes were placed in the shaker (180 rpm, 37°C) for 40 min and thereafter gently vortexed for 30 sec. The digested tissues were filtered through 100 um cell strainers followed by a second round of filtration through 40um cell strainers. Cell suspensions were centrifuged at 1800 rpm for 10 min to obtain lamina propria mononuclear cells. Both epithelial cell (EC) and lamina propria (LP) pellets were then resuspended into 500ul of RPMI (Gibco) containing 10% FBS+ 1µlRh103 +1µl IdU and incubated at 37°C for 20 min. 5 ml RPMI (+10%FBS) was added to each tube and spun at 1800 rpm to pellet cells. 700µl of Prot1 stabilizer (SmartTube Inc.) was added to each tube and transferred to cryovials and incubated at room temperature for 10 min. Cryovials were immediately transferred to –80 until the sample was acquired for mass cytometry as detailed below.

Blood collection and processing for CyTOF

Phlebotomy was performed on COVID-19 patients and non-COVID-19 controls at the time of endoscopic evaluation. All the blood samples from COVID-19 patients were processed in enhanced BSL2 conditions per institutional guidelines. Briefly, 15ml of LymphosepÒ - Lymphocyte Separation Medium (MP Bio.) was added to each 50 ml centrifugation tube. Blood was diluted with PBS to bring the volume up to 30ml and diluted blood was layered gently over LymphosepÒ. Tubes were then centrifuged at 2000 rpm for 20 mins with the brakes and acceleration off. After centrifugation, with a 3ml transfer pipet, the buffy coat containing PBMCs was transferred to another 15ml Falcon tube and was centrifuged at 1800 rpm for 10 mins. Pellets were resuspended in PBS and tubes were centrifuged at 1800 rpm for 10 mins. PBMC pellets were resuspended in the freezing medium (10% DMSO + 44% FBS in RPMI) and cryopreserved at −80 °C.

CyTOF processing and data acquisition

Cells were processed and as previously described⁹³ according to the manufacturer’s instructions. Briefly, EC and LP SmartTube proteomic stabilized samples were thawed in a 10°C water bath and washed with Cell Staining Buffer (Fluidigm). To facilitate data acquisition and doublet removal, multiple samples were also barcoded using Fluidigm Pd barcoding kits and then washed and pooled for data acquisition. Immediately prior to data acquisition, samples were washed with Cell Staining Buffer and Cell Acquisition Solution (Fluidigm) and resuspended at a concentration of 1 million cells per ml in Cell Acquisition Solution containing a 1:20 dilution of EQ Normalization beads (Fluidigm). The samples were then acquired on a Helios Mass Cytometer equipped with a wide-bore sample injector at an event rate of < 400 events per second. After acquisition, repeat acquisitions of the same sample concatenated and normalized using the Fluidigm software, and barcoded samples were de-multiplexed using the Zunder single cell debarcoder.

CyTOF Data analysis

De-barcoded files were uploaded to Cytobank for analyses. Immune cells were identified based on Ir-193 DNA intensity and CD45 expression; Ce140+ normalization beads, CD45-low/Ir-193-low debris and cross-sample and Gaussian ion-cloud multiplets were excluded from subsequent downstream analysis. Major immune cell types were identified using automated Astrolabe approach, the result of which largely correlated well with our manual gating approaches. The impact of each tested condition on relative staining quality was evaluated in two ways: 1) overall correlations were determined by calculating the Pearson’s correlation coefficients for the median expression of each marker across each defined immune subset; and 2) a staining index was calculated using defined populations showing the highest and lowest expression levels of each marker: SI = (Medianpos - Medianneg) / 2 X Std.Devneg. It is already shown that Smart Tubebased fixation protocols take into account previously described mass cytometry artifacts such as cell-cell multiplets, isotopic spillover or oxidation, or mass cytometer instrument configuration⁹³.

Statistical Analysis for CyTOF

Pre-gated viable CD45+ cells were first clustered and annotated using the Astrolabe Cytometry Platform (Astrolabe Diagnostics, Inc.), which involves using a hierarchy-based FlowSOM algorithm for labeling cell populations in individual samples. These Astrolabe Profiling clusters from each tissue type were then meta-clustered across all samples utilizing Clustergrammer2’s interactive heatmap as a method to interrogate antibody expression across every cluster and curate and assign cell population categories. Single sample clusters were also visualized using UMAP. Pairwise comparisons were performed on the frequencies of each identified cell population between the patient cohorts (COVID-19 vs. control, COVID-19 severe vs. control, COVID19-moderate vs. control) to determine fold change, p-values and FDR adjusted p-values using the Benjamini-Hochberg⁹⁰ method to account for multiple comparisons.

Cell Culture Experiments/ RNA isolation/ qPCR/Virus Isolation

African green monkey kidney epithelial cells (Vero E6) were originally purchased from American Type Culture Collection (ATCC). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) w/ L-glutamate, sodium pyruvate (Corning) supplemented with 10% fetal bovine serum (FBS), 100 U penicillin per ml, and 100 mg streptomycin per ml. For all experiments, the cells were always maintained in monolayers.

Several attempts were made to isolate live infectious particles from these biopsies. Briefly, biopsies were collected and stored in PBS until homogenization. Following homogenization and centrifugation (10,000 × g, 20 min, 4°C), the resulting supernatant tissue supernatant was inoculated onto Vero E6 monolayer maintained in optimal virus growth media for SARS-CoV-2 virus (DMEM w/ L-Glutamate, Sodium Pyruvate, 2% FBS, 100 U Penicillin/ml, and 100 mg Streptomycin/ml, 10 mM Non-Essential Amino Acids, 1 mM Sodium Pyruvate and 10 mM HEPES). Vero E6 cells were incubated at 37 °C, 5% CO2 for a week and monitored daily for potential cytopathic effect (CPE).

Cell culture supernatants were also collected and assessed for presence of infective particles by plaque assay. Briefly, ten-fold serial dilutions were performed in infection media for SARS-CoV-2 and inoculated onto confluent Vero E6 cell monolayer in 6-well plate. After one-hour adsorption, supernatants were removed, and cells monolayers were overlaid with minimum essential media (MEM) containing 2% FBS and purified agar (OXOID) at a final concentration of 0.7%. Cells were then incubated 3 days at 37°C. Cells were fixed overnight with 10% formaldehyde for inactivation of potential SARS CoV2 virus. Overlay was removed and cells were washed once with PBS. A 2% crystal violet solution was used for plaque visualization and count. Experiments were performed under BSL3 conditions.

Specimen Processing for Nucleic Acid Extraction

Whole biopsy tissues from COVID-19 patients and non COVID controls were directly homogenized in Trizol (Invitrogen) and used to detect the presence of viral RNA. In parallel, RNA isolated from epithelial compartment and lamina propria fractions from biopsies post-processing were used for transcriptomics analyses. Total RNA was extracted using Direct-zol RNA Miniprep Plus (Zymo) kit according to the manufacturer’s instructions.

RT-qPCR for Viral Determination

RNA was retro-transcribed using the enzyme Maxima First Strand cDNA (Thermofisher), and PCR reaction was performed using the TaqMan™ Universal PCR Master Mix (Thermofisher). For detection of SARS-CoV-2 RNA, we used the following primers and probe targeting the N gene: N1- SARS-CoV2-F5’GACCCCAAAATCAGCGAAAT; N1-SARS-CoV2-R5’TCTGGTTACTGCCAGTTGAATCTG; N1-SARS-CoV2-P FAM5’ ACCCCGCATTACGTTTGGTGGACC-BHQ-1 (https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html) Another set of primers was included to detect host 18s and GADPH. Limit of detection and amplification efficiency were calculated before GI tissue quantification for N1 (173%; R²>0.94) primers using plasmids expressing the NP protein (2019-nCoV_N_Positive Control, IDT, cat. 10006625). RNA from GI tissue were run in triplicate in 384 plates using the following cycling conditions on the Roche LightCycler 480 Instrument II (Roche Molecular Systems, 05015243001): 50 C for 2 min; 95 C for 10 min; 40 cycles of 95C for 15 sec and 60 C for 1 min. Samples below the limit of detection (Ct≥34 corresponding to 100 genome copies/reaction) were considered negative. Primers and probes for housekeeping genes GAPDH (assay ID Hs02758991_g1 FAM) and 18S (assay ID Hs03928990_g1 FAM) were obtained from Thermofisher Scientific).

Cell Culture Experiments/ Virus Isolation

African green monkey kidney epithelial cells (Vero E6) were originally purchased from American Type Culture Collection (ATCC). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) w/ L-glutamate, sodium pyruvate supplemented with 10% fetal bovine serum (FBS), 100 U penicillin per ml, and 100 mg streptomycin per ml. For all experiments, the cells were always maintained in monolayers.

Several attempts were made to isolate live infectious particles from these biopsies. Briefly, biopsies were collected and stored in PBS until homogenization. Following homogenization and centrifugation (10,000 × g, 20 min, 4°C), the resulting supernatant tissue supernatant was inoculated onto Vero E6 monolayer maintained in optimal virus growth media for SARS-CoV-2 virus (DMEM w/ L-Glutamate, Sodium Pyruvate, 2% FBS, 100 U Penicillin/ml, and 100 mg Streptomycin/ml, 10 mM Non-Essential Amino Acids, 1 mM Sodium Pyruvate and 10 mM HEPES). Vero E6 cells were incubated at 37 °C, 5% CO2 for a week and monitored daily for potential cytopathic effect (CPE).

Cell culture supernatants were also collected and assessed for presence of infective particles by plaque assay. Briefly, ten-fold serial dilutions were performed in infection media for SARS-CoV-2 and inoculated onto confluent Vero E6 cell monolayer in 6-well plate. After one-hour adsorption, supernatants were removed, and cells monolayers were overlaid with minimum essential media (MEM) containing 2% FBS and purified agar (OXOID) at a final concentration of 0.7%. Cells were then incubated 3 days at 37°C. Cells were fixed overnight with 10% formaldehyde for inactivation of potential SARS CoV2 virus. Overlay was removed and cells were washed once with PBS. A 2% crystal violet solution was used for plaque visualization and count. Experiments were performed under BSL3 conditions.

RNA Sequencing

Immunofluorescent (IF) microscopy

Formalin fixed, paraffin embedded tissue acquired during routine clinical care was obtained from the pathology core at our institution. Sections (5µm) were dewaxed in xylene and rehydrated in graded alcohol and then phosphate-buffered saline (PBS). Heat-induced epitope retrieval was performed by incubating slides in a pressure cooker for 15 minutes on high in target retrieval solution (Dako, S1699). Slides were then left to cool in the solution at room temperature for 30 minutes. Slides were washed twice in PBS and then permeabilized for 30 minutes in 0.1% tritonX-100 in PBS. Non-specific binding was blocked with 10% goat serum for 1 hour at room temperature. Sections were then incubated in primary antibodies diluted in blocking solution overnight at 4°C. Primary and secondary antibodies are summarized in Supplementary Table 11. Slides were washed in PBST (0.1% tween 20, PBS) 3 times and then incubated in secondary antibody and 4′,6-diamidino-2-phenylindole (1ug/mL) for 1 hour at room temperature. Sections were washed twice in PBST and once in PBS then mounted with Fluoromount-G (Electron microscopy sciences, 1798425). Controls included, omitting primary antibody (no primary control), or substituting primary antibodies with non-reactive antibodies of the same isotype (isotype control). Tissue was visualized and imaged using a Nikon Eclipse Ni microscope and digital SLR camera (Nikon, DS-Qi2).

Electron Microscopy (EM)

Biopsy specimens for electron microscopy were placed in 3% buffered glutaraldehyde. Following post-fixation in 1% osmium tetroxide, tissues were serially dehydrated and embedded in epoxy resin in standard fashion. One-micron toluidine-stained scout sections were prepared for light microscopic orientation; 80nm ultrathin sections for EM were stained with uranyl acetate and lead citrate and examined in a Hitachi 7650 transmission electron microscope at 80kV.