Abstract
There is a worldwide shortage of reagents to perform detection of SARS-CoV-2. Many clinical diagnostic laboratories rely on commercial platforms that provide integrated end-to-end solutions. While this provides established robust pipelines, there is a clear bottleneck in the supply of reagents given the current situation of extraordinary high demand. Some laboratories resort to implementing kit-free handling procedures, but many other small laboratories will not have the capacity to develop those and/or will perform manual handling of their samples. In order to provide multiple workflows for SARS-CoV-2 nucleic acid detection we compared several commercially available RNA extraction methods: QIAamp Viral RNA Mini Kit (QIAGEN), the recently developed RNAdvance Blood (Beckman) and Mag-Bind Viral DNA/RNA 96 Kit (Omega Bio-tek). We also compared different 1-step RT-qPCR Master Mix brands: TaqMan™ Fast Virus 1-Step Master Mix (ThermoFisher Scientific), qPCRBIO Probe 1-Step Go Lo-ROX (PCR Biosystems) and Luna® Universal Probe One-Step RT-qPCR Kit (NEB). We used the Centre for Disease Control (CDC) recommended primers that detect two regions of the viral N gene as well as those that detect the RdRP gene region as per Public Health England (PHE) guidelines (Charité/WHO/PHE). Our data show that the RNA extraction methods provide similar results. Amongst the qPCR reagents tested, TaqMan™ Fast Virus 1-Step Master Mix and Luna® Universal Probe One-Step RT-qPCR Kit proved most sensitive. The N1 and N2 primer-probes provide a more reliable detection than the RdRP_SARSr primer-probe set, particularly in samples with low viral titres. Importantly, we have implemented a protocol using heat inactivation and demonstrate that it has minimal impact on the sensitivity of the qPCR in clinical samples – potentially making SARS-CoV-2 testing portable to settings that do not have CL-3 facilities.
In summary, we provide several testing pipelines that can be easily implemented in other laboratories and have made all our protocols and SOPs freely available at https://osf.io/uebvj/.
Introduction
“Test, test, test” – this was the message from the World Health Organization’s Head Tedros Adhanom Ghebreyesus on the 16th of March 2020. To fight the exponential spread of SARS-CoV-2, measures of social distancing have been imposed in many countries worldwide. Initial results of these measures start to manifest in stagnant or dropping numbers of new infections. However, while preventative and therapeutic treatments for COVID-19 are developed, massive testing is required. Countries such as South Korea, Germany or Austria have been exemplary in their large testing efforts as well as their Track and Trace approach, and thus have been put forward as models for others to follow. Large scale PCR-based testing will determine who has detectable SARS-CoV-2 viral levels. This is particularly relevant in asymptomatic individuals and should also be central in implementing an ‘exit strategy’ plan.
In order to increase testing capacity, many countries rely on centralised efforts to build large diagnostic centres. However, the involvement of smaller academic or commercial laboratories is proving helpful and necessary too. These decentralised laboratories can repurpose existing equipment and technical expertise for SARS-CoV-2 testing. The UK government document “Guidance for organisations to seek supporting the COVID-19 testing programme” published on the 9th of April 2020, by the Department of Health and Social Care, clearly welcomes academic institutions to increase testing capacities within the UK referred here as NHS-helper labs. However, due to global high demand of the kits and reagents used in the WHO (World Health Organization), CDC (Centre for Disease Control, US), ECDC (European Centre for Disease Prevention and Control) and PHE (Public Health England) ratified testing strategies, the NHS-helper labs are encouraged to use alternative strategies that will not interfere with the reagent demand of larger testing facilities. Moreover, helper laboratories can provide their research expertise and experimental validation of other kits enabling clinical labs to benefit from their results. We set out to perform this task.
Here we describe different strategies for SARS-CoV-2 PCR-based detection by employing reagents that are not currently used in the NHS setting. Within the UK, the NHS agrees on the use of alternative RNA isolation and qPCR protocols, providing these have been internally validated and discussed with the local NHS partner. To increase visibility of these alternative strategies, we have created a webpage under the Open Science Framework platform (https://osf.io/uebvj/) that we hope will stimulate exchange between smaller laboratory facilities, increase confidence in tested alternative routes of RNA isolation and viral RNA amplification and thereby expedite the establishment of smaller academic testing centres.
Results and Discussion
Our pipelines are adaptable for both manual and automatic handling; we also employ heat inactivation of virus within the swabs for easier processing. We compare three RNA extraction methods, one column-based and two other magnetic beads-based that are currently or have the potential to be automatized. As a benchmark, we use the QIAamp Viral RNA Mini Kit (QIAGEN) as their proprietary buffer AVL inactivates SARS-CoV-2 according to CDC guidelines. We also validate three different one-step RT-qPCR kits. We use the CDC recommended N1 and N2 primer-probe sets [1] and compare these against the PHE recommended RdRP_SARSr primers [2]. We did not test efficiency of the reverse transcription (RT) step, as we had no access to in vitro transcribed RNA. For these validations, we received clinical swab material from St Thomas’ Hospital (London, UK) in collaboration with their Centre for Clinical Infection and Diagnostics Research and Viapath using their clinical pipeline. Detailed step to step standard operating procedures (SOPs) can be found at https://osf.io/uebvj/.
We have created a flowchart of the different processing steps and combinations in our pipeline (Figure 1), which we subsequently explain in more detail.
RNA isolation methods
To test the efficiency and detection range of the CDC-recommended N1 and N2 primer-probes, we amplified serial dilutions of plasmids encoding the N SARS-CoV-2 gene (positive controls provided by Integrated DNA Technologies, IDT) using the TaqMan™ Fast Virus 1-Step Master Mix (Figure 2A), FastVirus hereafter. Good linearity could be achieved up to 10 copies of DNA molecules. Using the N1 and N2 primer-probes, we compared the efficiency of RNA recovery between the column-based QIAamp Viral RNA Mini Kit (QIAGEN, QIAmp herein) endorsed by the CDC, and two magnetic bead extraction kits: the RNAdvance Blood (Beckman) and Mag-Bind Viral DNA/RNA 96 Kit (Omega Bio-tek, Omega herein), starting from the same material (140 μL). Isolation of RNA from four different coronavirus positive samples (CPS) with all three kits rendered comparable cycle thresholds (Cts) when amplified with the primer-probes N1 and N2. This was the case for two different RT-qPCR Master Mixes, FastVirus (Figure 2B) or Luna® Universal Probe One-Step RT-qPCR Kit (NEB, Luna hereafter) (Figure 2C). Although global shortages on the QIAamp have been reported, both bead-based kits are currently widely available - prioritizing laboratories that are dedicated to diagnostics of COVID-19.
One step RT-qPCR master mix kits
We also compared different one-step RT-qPCR kits to amplify swab-material purified using the QIAamp viral RNA mini kit which we considered our ‘benchmark’ given CDC-guidelines on buffer AVL inactivating SARS-CoV-2. Figure 3 shows RNA from ten different donors (Viapath positive samples, VPS) amplified with FastVirus, qPCRBIO Probe 1-Step Go Lo-ROX (PCR Biosystems, qPCRBio) and Luna. All Master Mixes detected comparable amounts of RNA within the QIAamp purified sample using primer-probes against N1 primer-probe, with the exception of donors CPS_101 which had borderline Ct values of 38 in both FastVirus and Luna and was undetectable using qPCRBio Master Mix.
Primer-probe limit of detection
So far, we have established that three different RNA extraction kits, and three different one-step RT-qPCR kits achieve almost comparable detection of viral RNA within swab material.
As a diagnostic assay, it is paramount to be able to detect very low viral loads in swab samples. To determine the efficiency of the RT-qPCR we serially diluted the RNA from a confirmed positive swab isolated with each one of the three different kits used in this study and assessed with the N1 and N2 primer-probe amplification employing the Luna Master Mix. Figure 4A shows that the RT-qPCR reaction remains linear over a 100 000-fold dilution range. To ensure that low viral yields can be reliably detected with each one of these methods, we prepared serial dilutions of swab material from three different CPS donors in Hank’s Balanced Salt Solution (HBSS) + 1% bovine serum albumin (BSA) since viral transport medium contains these only with the addition of amphotericin and gentamicin. Viral RNA was isolated from these diluted swabs with the three RNA isolation kits from Figure 2. Figure 4B shows that all three kits recover viral RNA over a wide range of concentrations, with the N gene being reliably amplified with the Luna Master Mix and the N1 or N2 primer-probe sets. CPS21 10−1 dilution was excluded from the r calculations. Only N2 primer-probe set in the donor CPS79 extracted with Omega showed poor linearity, possibly related to initial variation in the non-diluted sample.
Heat inactivation
One major limitation for many academic and commercial laboratory settings is the lack of available CL-3 laboratory space and/or Class I MSCs required to handle/open the potentially infectious swabs. Moreover, samples with high viral load pose a risk of infection for the handler. Most recommended viral inactivation protocols use a combination of guanidinium thiocyanate (GTC) and Triton X-100. However, GTC is currently on backorder in several countries and the use of chemical inactivation protocols implies opening of the swab sample. Recently, heat treatment of viral particles has been shown effective in inactivating SARS-CoV-2 [3] with 70°C 5min treatment rendering viral infectivity undetectable employing Vero-6 cells (limit of detection of TCID50 assay is 100 TCID50/mL). Moreover, the American Type Culture Collection provides heat inactivated SARS-CoV-2 (ATCC® VR-1986HK™) employing 65°C for 30min and recommending BSL-1 for its handling [4]. We therefore assessed if heat treatment of nasopharyngeal swab-material constitutes a method of treating samples within their original unopened collection tubes without compromising RT-qPCR results. Data shown were obtained employing QIAamp RNA extraction. We increased the exposure times and carried out the experiments in our CL-3 laboratory, up to the point of chemical viral inactivation as acknowledged by the CDC, as a precaution, since we did not have this information when we initiated these experiments.
We first assessed heating sample aliquots with 70°C for 10min in five samples (same ones as Figure 3). No changes in Ct values were seen (Figure 5A) in any of our primer-probe sets (N1, N2, RdRP) employing FastVirus Master Mix. We then employed 70°C for 30min with different samples and performed RT-qPCR with N1 primer-probes and Luna Master Mix. As Figure 5B shows, we did not observe any drop in Ct values upon heat treatment of the sample.
We then set out to test a wider range of heat-inactivation conditions on six confirmed positive samples. We treated aliquots of the same sample with no heat, 70°C for 10min, 70°C for 30min, 90°C for 10min or 90°C for 30min and extracted RNA employing the QIAamp kit. We employed a dry metallic bead bath to heat the sample tubes, since water baths are not allowed in this setting due to the risk of spillage and complex decontamination in case of spillage. Our results show that none of the heat conditions altered the Ct values (Figure 5C). Both the N1 and N2 primer-probe sets gave reliable and near-identical amplification of viral RNA; however, we noticed that the RdRP primer-probe set failed to amplify viral samples with high Ct values. These results of high Ct values for RdRP were also observed when we used the MagMax kit (ThermoFisher Scientific) as an extra RNA extraction method (Supplementary Figure 1). Comparison of the different primer-probe combination for RdRP rendered similar results (Supplementary Figure 2) and as previously shown [5]. This important finding should be considered when laboratories decide to rely only on one primer-probe set.
To confirm the reproducibility of our results, we employed another distinct set of samples, assessing both positive and negative samples. We aliquoted swab material, warmed it at 70°C for 30min, extracted their RNA using QIAmp and performed RT-qPCR using Luna Master Mix using primer-probe N1. Ct values did not change upon heat inactivation as observed previously. However, we determined multiple instances where swabs previously identified as negative amplified in one of the RT-qPCR duplicates at high Ct values of around 38 (Figure 5D). All our water controls (no template and water template) yielded no amplification.
Conclusions
In conclusion, we have presented data employing our in-house validation of two viral RNA purification kits (Beckman and Omega) that could be used as suitable alternatives to the QIAamp viral RNA mini kit – which render comparable results. We have also tested three alternative, commercially available one step RT-qPCR kits (FastVirus, Luna and PCRBio) with FastVirus and Luna showing better results but PCRBio also being also a good alternative. We have also assessed different recommended primer-probe sets (N1, N2, RdRP). We find that N1 and N2 primer-probe are more sensitive than RdRP. Finally, and possibly most importantly, we show that heat inactivation of virus within swab-material does not affect viral RNA detection and may be used to reduce the need for CL-3 laboratory where no closed automatization of the sample-extraction procedure is possible. Our pipeline can therefore be implemented in places that only have CL-2 facilities to help with diagnostic detection of SARS-CoV-2.
Based on the above, and understanding that including RT-qPCR duplicates may decrease the number of samples a diagnostic laboratory can process (particularly if employing 96 well plates), we suggest to:
employ heat (70°C or 90°C) for 30min;
preferably employ N1 and N2 primer-probes vs RdRP;
test samples without replicates to increase the testing throughput;
run duplicates in case of borderline ≥ 38Ct. If 1) amplification is shown reproducibly consider it a positive sample with low viral load 2) amplification unclear (one replicate yes, one not) for these donors to be re-swabbed 3-5 days later to confirm positive or negative detection of SARS-CoV-2. Although we acknowledge the limitations, if possible, re-swabbing of doubtful samples is highly recommended as a first option.
Data Availability
All raw data files are available to anyone that requires them. Our protocols are also published at https://osf.io/uebvj/
Materials and Methods
All materials with their catalogue numbers are available at https://osf.io/uebvj/.
Heat inactivation
Swab tubes containing Viral Transport Medium (VTM) were checked for cracks to ensure no viral material had leaked, and briefly centrifuged to ensure no VTM remained in the lid. Swab tubes were then transferred to a water bath (Grant) containing dry metallic beads (Starlab) preheated to 70°C or 90°C, ensuring the entire swab tube (including lid) was covered by the beads. Samples were incubated in the following conditions: 70°C for 10 mins, 70°C for 30 mins, 90°C for 10 mins, or 90°C for 30 mins, then transferred back to Class I MSC and allowed to cool to room temperature prior to RNA extraction.
RNA Extraction
Qiagen QIAamp Viral RNA Mini Kit
From swab tube, 140 µl sample was transferred to 1.5 mL screw-cap microcentrifuge tube and treated with 560 µl AVE, containing carrier RNA, followed by 560 µl molecular-grade 100% ethanol (Fisher Scientific). Samples were then taken out of the Class I MSC and CL-3 lab as AVL is known to inactivate SARS-CoV-2, transferred into QiaAmp mini spin columns (Qiagen) and centrifuged according to manufacturer’s instructions. Two wash steps were performed, with 714 µl buffer AW1 and 714 µl buffer AW2 (both Qiagen). RNA was then eluted from the columns with 40 µl RNase-free water (Ambion), followed by a second 40 µl elution to maximise RNA yield and giving a final RNA sample volume of 80 µl.
Beckman Coulter Agencourt RNAdvance Blood Total RNA Kit
Reagents were prepared prior to RNA extraction according to manufacturer’s instructions. The protocol was conducted in a Class I MSC in a CL-3 lab. From a swab tube, 140 µl were transferred to a Zymo-Spin I-96 Plate (Zymo Research). 7 μl of Proteinase K/PK buffer and 105 µl of Lysis buffer was added to each sample, mixed and incubated at room temperature for 15 minutes. Following incubation, 143 μl of Bind1/Isopropanol was added to each sample, mixed, and the samples were left to incubate at room temperature for 5 min. The Zymo-Spin I-96 Plate was placed on ZR-96 MagStand (Zymo Research), and the magnetic beads left to form a pellet. The supernatant was removed, and the magnetic beads washed three times, first, with 280 μl of Wash buffer (Beckman Coulter), followed by two washes with 70% ethanol. Following the wash steps, RNA was eluted from the columns with 80 µl RNase-free water (Ambion).
Omega Bio-tek Mag-Bind® Viral DNA/RNA kit
Reagents were prepared prior to RNA extraction according to manufacturer’s instructions. The protocol was conducted in a Class I MSC in a CL-3 lab. From a swab tube, 140 µl sample was transferred to a Zymo-Spin I-96 Plate (Zymo Research). 369.5 μl of Lysis mastermix was added to each sample, mixed, and incubated at room temperature for 10 minutes. Following incubation, 7 μl of Mag-Bind® Particles CNR and 7 μl of Proteinase K solution was added to each sample, mixed and incubated at room temperature for 5 minutes. The Zymo-Spin I-96 Plate was placed on ZR-96 MagStand (Zymo Research), and the magnetic beads left to form a pellet. The supernatant was removed, and the magnetic beads washed three times, first, with 280 μl of VHB buffer (Omega Bio-tek), followed by two washes with 350 μl SPR Wash Buffer (Omega Bio-tek). Following the wash steps, RNA was eluted from the columns with 80 µl RNase-free water (Ambion).
2019-nCoV detection probes and primers
Centers for Disease Control and Prevention (CDC) recommended probes and primers
2019-nCoV_N1-P (FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1), 2019-nCoV_N1-F (GACCCCAAAATCAGCGAAAT), 2019-nCoV_N1-R (TCTGGTTACTGCCAGTTGAATCTG), 2019-nCoV_N2-P (FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1), 2019-nCoV_N2-F (TTACAAACATTGGCCGCAAA), 2019-nCoV_N2-R (GCGCGACATTCCGAAGAA), RP-P (FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1), RP-F (AGATTTGGACCTGCGAGCG), and RP-R (GAGCGGCTGTCTCCACAAGT) were ordered from Integrated DNA Technologies (2019-nCoV CDC EUA Kit). Each primer/probe set (N1, N2, RNAseP) comes premixed at the recommended concentrations by the CDC.
Charité/World Health Organization (WHO)/Public Health England (PHE) probes and primers
RdRP_SARSr-P2 (6FAM -CAggTggAACCTCATCAggAgATgC-BBQ) were ordered from TIB MOLBIOL (Germany). RdRP_SARSr-F2 (GTGARATGGTCATGTGTGGCGG) and RdRP_SARSr-R1 (CARATGTTAAASACACTATTAGCATA) were ordered from Eurofins. We did not employ RdRP_SARSr-P1 (6FAM-CCAggTggWACRTCATCMggTgATgC-BBQ) except for Supplementary Figure 2 - as this probe is not specific for SARS-CoV-2 but generic for coronaviruses. Probes were HPLC-purified by the manufacturer. W is A/T; R is G/A; M is A/C.
One-step RT-qPCR
qPCRBIO Probe 1-Step Go Lo-ROX (PCR Biosystems)
Reactions were done with 5 µL RNA, 5 µL 2x qPCRBIO Probe 1-Step Go mix, 1.2 µL forward primer RdRP_SARSr-F2 (10 µM), 1.6 µL reverse primer RdRP_SARSr-R1 (10 µM), and 0.2 µL probe RdRP_SARSr-P2 (10 µM), 2 µL of 20x RTase Go, and completed with RNase-free water to 20 µL. The samples were incubated in a QuantStudio 5 (Applied Biosystems/ThermoFisher Scientific). Reverse transcription was performed for 10 minutes at 45°C. The DNA polymerase was activated for 2 minutes at 95°C and the samples underwent 50 cycles of denaturation (5 seconds at 95°C) and annealing/extension (30 seconds at 60°C). A plate read was included at the end of each extension step. Each sample was run in duplicate.
TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems)
Reactions were performed with 5 µL RNA, 5 µL TaqMan Fast Virus 1-Step master mix, with probes and water making the 20 µL reaction. For Charité/WHO/PHE primers, 1.2 µL forward primer RdRP_SARSr-F2 (10 µM), 1.6 µL reverse primer RdRP_SARSr-R1 (10 µM), and 0.2 µL probe RdRP_SARSr-P2 (10 µM), and 7 µL RNase-free water were used. For CDC primers, 1.5 µL of each primer-probe premixture (N1, N2 or RNAseP) and 8.5 µL water were used. The samples were run in a QuantStudio 5 (Applied Biosystems/ThermoFisher Scientific) using the “Fast” cycling mode. Reverse transcription was performed for 5 minutes at 50°C. The reverse-transcriptase was then inactivated for 20 seconds at 95°C and the samples underwent 50 cycles of denaturation (3 seconds at 95°C) and annealing/extension (30 seconds at 60°C). A plate read was included at the end of each extension step. Each sample was run in duplicate.
Luna Universal Probe One-Step RT-qPCR (NEB)
Reactions were performed with 5 µL RNA, 10 µL 2x Luna Universal Probe One-Step reaction mix, 1 µL Luna WarmStart RT enzyme mix, 1.5 µL of each CDC primer-probe premixture (N1, N2 or RNAseP), and 2.5 µL RNase-free water. The samples were incubated in a QuantStudio 5 (Applied Biosystems/ThermoFisher Scientific) using the “Fast” cycling mode. Reverse transcription was performed for 10 minutes at 55°C. The samples were denatured for 1 minute at 95°C and then underwent 50 cycles of denaturation (10 seconds at 95°C) and annealing/extension (30 seconds at 60°C). A plate read was included at the end of each extension step. Each sample was run in duplicate.
Supplementary Material
Supplementary Methods
MagMAX RNA isolation using MagMAX−-96 Total RNA Isolation Kit (AM1830)
After heat treatment/no heat treatment of nasopharyngeal swab within Class I MSC of CL-3 lab, 100 µl of sample was transferred to 1.5mL tubes and 300 µl TRIzol− Reagent (Thermofisher 15596018) added. Samples were vortexed and incubated at room temperature for 5 mins. 40 µl chloroform was added, samples vortexed and incubated for a further 5 mins. Samples were transferred to a CL-2 lab for further processing and spun at 12000g at 4°C for 10 mins. 100ul of the upper aqueous phase was then transferred to a 96-well plate, 50 µl 100% isopropanol added, and samples vortexed/shaken for 1 min. RNA binding beads (Thermofisher Scientific) were first vortexed to resuspend, then 10ul was added to each sample, and the plate vortexed/shaken for a further 3 mins. The plate was placed onto a 96-well magnetic stand (Thermofisher Scientific) for approximately 2 mins, until the supernatant was completely clear. All of the supernatant was removed carefully, without disturbing the beads. 150 µl Wash 2 (Thermofisher Scientific) was added and the plate vortexed/shaken for 1 min. The plate was placed on the magnet until supernatant clear, and the supernatant removed. This step was repeated, using another 150 µl Wash 2. Once the last supernatant was removed the plate was vortexed/shaken for 2 minutes to dry the beads. 50 µl Elution Buffer (Thermofisher Scientific) was added to each sample and the plate vortexed/shaken vigorously for 3 mins. The plate was placed on the magnet, and once clear the supernatant containing total RNA was removed and transferred to a clean 96-well plate.
Acknowledgements and Funding
This work was funded by King’s Together Rapid COVID-19 Call award to R.T.M-N. A.S. was supported by the MRC-KCL Doctoral Training Partnership in Biomedical Sciences (MR/N013700/1); EOZ was supported by MR/S009191/1 to Parsons M and Santis G; M.F. was supported by the UK Medical Research Council (MR/R50225X/1) and is a King’s College London member of the MRC Doctoral Training Partnership in Biomedical Sciences; R.E.D. is a King’s College London member of the MRC Doctoral Training Partnership in Biomedical Sciences; H.S was supported by the BBSRC (BB/P504609/1); G.B. was supported by the Wellcome Trust (106223/Z/14/Z to MHM); R.P. was supported by the by the (NIHR) Biomedical Research Centre based at Guy’s and St Thomas’ NHS Foundation Trust and King’s College London; T.J.A.M. was supported by Asthma UK at the Asthma UK Centre in Allergic Mechanisms of Asthma; P.M., S. P. and H.W. were supported by WT098049AIA to Neil S. and Swanson C.; M.J.L.B and C.B. were supported by MRC: MR/S000844/1 to Neil S. and Swanson C. This UK funded award is part of the EDCTP2 programme supported by the European Union; K.P. was funded by KHP Challenge Fund to R.T.M-N; M.H. was funded by RP_007_20190305 from Kidney research UK; H.M. was funded by the Wellcome Trust and Royal Society Sir Henry Dale Fellowship 218537/Z/19/Z.