Culture and identification of a “Deltamicron” SARS-CoV-2 in a three cases cluster in southern France
========================================================================================================

* Philippe Colson
* Pierre-Edouard Fournier
* Jeremy Delerce
* Matthieu Million
* Marielle Bedotto
* Linda Houhamdi
* Nouara Yahi
* Jeremy Bayette
* Anthony Levasseur
* Jacques Fantini
* Didier Raoult
* Bernard La Scola

## ABSTRACT

Multiple SARS-CoV-2 variants have successively, or concommitantly spread worldwide since summer 2020. A few co-infections with different variants were reported and genetic recombinations, common among coronaviruses, were reported or suspected based on co-detection of signature mutations of different variants in a given genome. Here were report three infections in southern France with a Delta 21J/AY.4-Omicron 21K/BA.1 “Deltamicron” recombinant. The hybrid genome harbors signature mutations of the two lineages, supported by a mean sequencing depth of 1,163-1,421 reads and mean nucleotide diversity of 0.1-0.6%. It is composed of the near full-length spike gene (from codons 156-179) of an Omicron 21K/BA.1 variant in a Delta 21J/AY.4 lineage backbone. It is similar to those reported for 15 other patients sampled since January 2022 in Europe. Importantly, we cultured an isolate of this recombinant and sequenced its genome. It was observed by scanning electron microscopy. As it is misidentified with current variant screening qPCR, we designed and implemented for routine diagnosis a specific duplex qPCR. Finally, structural analysis of the recombinant spike suggested its hybrid content could optimize viral binding to the host cell membrane. These findings prompt further studies of the virological, epidemiological, and clinical features of this recombinant.

Key words
*   SARS-CoV-2
*   recombinant
*   variant
*   lineage
*   Delta
*   Omicron
*   Deltamicron
*   epidemic

## Introduction

The current SARS-CoV-2 pandemic has highlighted since the summer of 2020 the successive or concomittant emergence of numerous viral variants, each causing a specific epidemic (Lemey et al., 2021, Hodcroft et al., 2021; Colson et al., 2022b). Some of these variants spread to become pandemic while others remained epidemic in a restricted geographical area. The variants characterized so far have been shaped by nucleotide substitutions, insertions or deletions. However, another major evolutionary mechanism of RNA viruses is genetic recombination, which is very common among coronaviruses (Lai, 1996; Zhang et al., 2015; Xiao et al., 2017; So et al., 2019; Gribble et al., 2021). It requires co-infection of the same host cell by two viruses, which may be two distinct mutants or variants (Bentley et al., 2018). Therefore, the frequency of creation of recombinants between two variants depends on the duration of their co-circulation, on the time until viral clearance, and on the number of people exposed to both viruses. Co-infections with two variants were reported including recently with SARS-CoV-2 Delta and Omicron variants (Jackson et al., 2021; Francisco et al., 2021; Taghizadeh et al., 2021; Rockett et al., 2022). Furthermore, genetic recombinations were reported or suspected, based on the concurrent detection in consensus genomes of signature mutations of different mutants or variants (Yi, 2020; Yeh and Contreras, 2020; VanInsberghe et al., 2020; Gallaher, 2020; Jackson et al., 2021; Haddad et al., 2021; Makarenkov et al., 2021; Varabyou et al., 2021; Leary et al., 2021; Taghizadeh et al., 2021; Lohrasbi-Nejad, 2022; Kreier, 2022; Ignatieva et al., 2022). A study detected up to 1,175 (0.2%) putative recombinant genomes among 537,360 genomes from the GISAID database and estimated that up to 5% SARS-CoV-2 having circulated in the USA and UK could be recombinants (VanInsberghe et al., 2020).

Two pandemic variants, Delta and Omicron 21K [Nextclade classification (Aksamentov et al., 2021)]/BA.1 [Pangolin classification (Rambaut et al., 2020)], recently succeeded each other as the predominant viruses but co-circulated for a period of several weeks, creating conditions for co-infections and subsequently recombinations. This period spanned between December 27th, 2021 and February 14th, 2022 in our geographical area, as assessed by our SARS-CoV-2 genotypic surveillance based on variant-specific qPCR and next-generation genomic sequencing (Colson et al., 2022b; Colson et al., 2022a). In January 2022, genomes harboring mutations from both Delta and Omicron 21K/BA.1 variants were reported in Cyprus but it was questioned whether sequences might have resulted from contamination (Kreier, 2022). Still, genomes being hybrids of these two variants and highly similar between each other were reported since February 2022, and their number in the GISAID database amounted to 15 as of 27/02/2022 ([https://github.com/cov-lineages/pango-designation/issues/444](https://github.com/cov-lineages/pango-designation/issues/444)). We herein report three infections by a recombinant SARS-CoV-2 Delta 21K/AY.4-Omicron 21K/BA.1 whose genome is highly similar to the 15 previously reported genomes and the isolation of the recombinant virus from one of the patients.

## Materials and methods

Nasopharyngeal samples were collected from two patients in our university hospital institute (Méditerranée Infection; [https://www.mediterranee-infection.com/](https://www.mediterranee-infection.com/)) and tested for SARS-CoV-2 infection by real-time reverse transcription-PCR (qPCR) as previously described (Colson et al., 2022b; Houhamdi et al., 2022). The third patient was sampled in a private medical biology laboratory in southern France (Inovie Labosud, Montpellier, France). qPCR assays that screen for SARS-CoV-2 variants were performed as recommended by French public health authorities ([https://www.data.gouv.fr/fr/datasets/donnees-de-laboratoires-pour-le-depistage-indicateurs-sur-les-mutations/](https://www.data.gouv.fr/fr/datasets/donnees-de-laboratoires-pour-le-depistage-indicateurs-sur-les-mutations/)). In our center this included the detection of spike mutation among which K417N (Thermo Fisher Scientific, Waltham, USA), combined with testing with the TaqPath COVID-19 kit (Thermo Fisher Scientific) that target viral genes ORF1, N (nucleocapsid) and S (spike), as previously reported (Colson et al., 2022b; Colson et al., 2022a). The private medical laboratory used the ID SARS-CoV-2/VOC Revolution Pentaplex assay (ID Solutions, Grabels, France) that detects spike mutations K417N, L452R, and E484K (Pentaplex assay, ID Solution, France).

SARS-CoV-2 genomes were sequenced in the framework of genomic surveillance implemented since February 2020 (Colson et al., 2022b) in our institute and as recommended by French public health authorities since 2021 ([https://www.santepubliquefrance.fr/dossiers/coronavirus-covid-19/consortium-emergen#block-356295](https://www.santepubliquefrance.fr/dossiers/coronavirus-covid-19/consortium-emergen#block-356295)). Next-generation sequencing was performed with the Illumina COVID-seq protocol on the NovaSeq 6000 instrument (Illumina Inc., San Diego, CA, USA) or with the Oxford Nanopore technology (ONT) on a GridION instrument (Oxford Nanopore Technologies Ltd., Oxford, UK) combined with prior multiplex PCR amplification according to the ARTIC procedure ([https://artic.network/](https://artic.network/)), as previously described (Colson et al., 2022b; Colson et al., 2022a), with the ARTIC nCoV-2019 Amplicon Panel v4.1 of primers (IDT, Coralville, IA, USA). Then, sequence read processing and genome analysis were performed as previously described (Colson et al., 2022b; Colson et al., 2022a). Briefly, for Illumina NovaSeq reads, base calling was performed with the Dragen Bcl Convert pipeline [v3.9.3; [https://emea.support.illumina.com/sequencing/sequencing\_software/bcl-convert.html](https://emea.support.illumina.com/sequencing/sequencing\_software/bcl-convert.html) (Illumina Inc.)], mapping was performed with the bwa-mem2 tool ([https://github.com/bwa-mem2/bwa-mem2](https://github.com/bwa-mem2/bwa-mem2)) on the Wuhan-Hu-1 isolate genome (GenBank accession no. [NC\_045512.2](http://medrxiv.org/lookup/external-ref?link\_type=GEN&access\_num=NC\_045512.2&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom)) then cleaned with Samtools ([https://www.htslib.org/](https://www.htslib.org/)), variant calling was carried out with freebayes ([https://github.com/freebayes/freebayes](https://github.com/freebayes/freebayes)) and consensus genomes were built using Bcftools ([https://samtools.github.io/bcftools/bcftools.html](https://samtools.github.io/bcftools/bcftools.html)). ONT reads were processed with the ARTIC field bioinformatics pipeline ([https://github.com/artic-network/fieldbioinformatics](https://github.com/artic-network/fieldbioinformatics)). Nucleotide and amino acid changes relatively to the Wuhan-Hu-1 isolate genome were obtained using the Nextclade tool ([https://clades.nextstrain.org/](https://clades.nextstrain.org/)) (Aksamentov et al., 2021; Rambaut et al., 2020). Nextstrain clades and Pangolin lineages were determined using the Nextclade web application ([https://clades.nextstrain.org/](https://clades.nextstrain.org/)) (Aksamentov et al., 2021) and the Pangolin tool ([https://cov-lineages.org/pangolin.html](https://cov-lineages.org/pangolin.html)) (Rambaut et al., 2020), respectively. Genome sequences described here were deposited in the GISAID sequence database ([https://www.gisaid.org/](https://www.gisaid.org/)) (EPI\_ISL\_10528736, EPI\_ISL\_10531214, EPI\_ISL_10529499, EPI_ISL_10640045) (Alm et al., 2020). The Simplot software ([https://sray.med.som.jhmi.edu/SCRoftware/SimPlot/](https://sray.med.som.jhmi.edu/SCRoftware/SimPlot/)) was used for recombination analysis. Phylogeny was reconstructed by the nextstrain/ncov tool ([https://github.com/nextstrain/ncov](https://github.com/nextstrain/ncov)) and visualized with Auspice ([https://docs.nextstrain.org/projects/auspice/en/stable/](https://docs.nextstrain.org/projects/auspice/en/stable/)). Genomes the closest genetically to those obtained here were selected among Delta 21J/AY.4 genomes recovered from GISAID based on their mutation pattern, then incorporated in the phylogeny together with the genome of the Wuhan-Hu-1 isolate.

SARS-CoV-2 culture isolation was performed by inoculating 200 µL of respiratory sample on Vero E6 cells as previously described (La Scola et al., 2020). Cytopathic effect was observed by inverted microscopy. Viral particles were visualized in the culture supernatant by scanning electron microscopy with a SU5000 microscope (Hitachi High-Technologies Corporation, Tokyo, Japan), as previously described (Colson et al., 2020).

Structural predictions of the spike protein were performed as previously described (Fantini et al., 2021; Fantini et al., 2022; Colson et al., 2022a). Briefly, amino acid changes were introduced in the framework of a complete 14-1,200 structure of the original SARS-CoV-2 20B spike and missing amino acids were incorporated with the Robetta protein structure prediction tool ([https://robetta.bakerlab.org/](https://robetta.bakerlab.org/)) before energy minimization through the Polak-Ribière algorithm.

A in house duplex qPCR assay specific of the SARS-CoV-2 recombinant was designed that targets the genomes of the Delta 21J [targeted mutation: A11201G in the Nsp6 gene (corresponding to amino acid substitution T77A)] and the Omicron 21K/BA.1 [targeted mutations: A23040G, G23048A, A23055G in the spike gene (Q493R, G496S, Q498R)] variants. The sequences of the primers and probes (in 5’-3’ orientation) are as follows: (i) for the Delta 21J-targeting system: forward primer, CTGCTTTTGCAATGATGTTTGT; reverse primer, TACGCATCACCCAACTAGCA; probe, 6FAM-CTTGCCGCTGTAGCTTATTTTAAT (primers and probe concentrations in the mix were 200 nM and 150 nM, respectively); (ii) for the Omicron 21K/BA.1-targeting system: forward primer, CCTTGTAATGGTGTTGAAGGTTTT; reverse primer, CTGGTGCATGTAGAAGTTCAAAAG; probe, 6VIC-TTTACGATCATATAGTTTCCGACCC (primers and probe concentrations in the mix were 250 nM and 200 nM, respectively).

This study was approved by the ethics committee of University Hospital Institute Méditerranée Infection (No. 2022-001).

## Results

The three case-patients were SARS-CoV-2-diagnosed on nasopharyngeal samples collected in February 2022. Cycle threshold values (Ct) of diagnostic qPCR were between 20-31. The patients were below 40 years of age. They resided in southern France and did not travel abroad recently. They presented mild respiratory symptoms. Two were vaccinated against SARS-CoV-2 (with two or three doses administered). Variant screening qPCR for the 2 samples collected in our institute showed positivity for the K417N mutation while the TaqPath COVID-19 kit (Thermo Fisher Scientific, Waltham, USA) provided positive signals for all three genes targeted (ORF1, S, and N). The third sample showed positivity for the K417N mutation and negativity for the L452R and E484K mutations. Thus, overall, qPCR carried out on the three samples were indicative of a Omicron variant.

Viral genomes (GISAID accession no. EPI\_ISL\_10528736, EPI\_ISL_10531214, and EPI_ISL_10529499) from two of the three patients were identical and clustered in the phylogenetic analysis (**Figure 1**) despite no epidemiological link was documented between these two patients. The third genome exhibited 5 nucleotide differences. These 3 genomes were hybrids of Delta 21J AY.4 and Omicron 21K/BA.1 variant genomes (**Figure 2; Table 1**). At positions harboring mutations compared to the genome of the Wuhan-Hu-1 isolate, mean sequencing depth was between 1,163-1,421 reads and mean prevalence of the majoritary nucleotide was between 99.4-99.9% (with minimum values between 80.3-98.7%), ruling out the concurrent presence of two variants in the samples either due to co-infection or to contamination. In addition, the 3 genomes were phylogenetically-related to 15 Delta 21J/AY.4-Omicron 21K/BA.1 recombinant genomes previously detected in northern France, Denmark, and the Netherlands, and obtained from samples collected between January 3rd, 2021 (in the French region Hauts-de-France) and February 16th, 2022 in Denmark (**Figure 1**). Phylogenetic analysis and time estimation based on estimated SARS-CoV-2 mutation rate [≈1 mutation every 2 weeks (Van Dorp et al., 2020)] allowed estimating that the ancestor of this recombinant might have emerged in December 2021.

View this table:
[Table 1.](http://medrxiv.org/content/early/2022/03/08/2022.03.03.22271812/T1)

Table 1. 
**Nucleotide and amino acid changes in the Deltamicron recombinant according to their presence/absence in the Delta 21J/AY.4 lineage and the Omicron 21K/BA.1 variant**.

![Figure 1.](http://medrxiv.org/https://www.medrxiv.org/content/medrxiv/early/2022/03/08/2022.03.03.22271812/F1.medium.gif)

[Figure 1.](http://medrxiv.org/content/early/2022/03/08/2022.03.03.22271812/F1)

Figure 1. Phylogeny reconstruction based on SARS-CoV-2 Delta 21J/AY.4-Omicron 21K/BA.1 genomes.
Phylogenetic analysis was performed using the nextstrain/ncov tool ([https://github.com/nextstrain/ncov](https://github.com/nextstrain/ncov)) then visualized with Auspice ([https://docs.nextstrain.org/projects/auspice/en/stable/](https://docs.nextstrain.org/projects/auspice/en/stable/)). X-axis shows time. Sequences are labelled with GISAID identifiers (([https://www.gisaid.org/](https://www.gisaid.org/)) (Alm et al., 2020).

![Figure 2.](http://medrxiv.org/https://www.medrxiv.org/content/medrxiv/early/2022/03/08/2022.03.03.22271812/F2.medium.gif)

[Figure 2.](http://medrxiv.org/content/early/2022/03/08/2022.03.03.22271812/F2)

Figure 2. Schematic of the SARS-CoV-2 Delta 21J/AY.4-Omicron 21K/BA.1 recombinant genome.
a. Map of the SARS-CoV-2 genome.

b. Schematic representation of parental and recombinant genomes.

c. Mutations in the three Delta 21J/AY.4-Omicron 21K/BA1 recombinant genomes. Adapted from screenshots of the nextclade web application output ([https://clades.nextstrain.org](https://clades.nextstrain.org)) (Hadfield et al., 2018; Aksamentov et al., 2021). Color codes for nucleotide mutations and are marked regions as follows: Green: U; yellow: G; blue: C; red: A; grey: deletions or uncovered regions.

In this SARS-CoV-2 recombinant, most of the spike gene was replaced in a Delta 21J/AY.4 matrix by an Omicron 21K/BA.1 sequence (**Figure 2**). Indeed, the recombination sites were located between nucleotide positions 22,029-22,034 and 22,097 for the first one, and between nucleotide positions 25,469 and 25,584 for the second one. These regions corresponds to amino acids 156 to 179 of the spike protein and to amino acids 26 to 64 of the ORF3 protein whose gene is contiguous to the spike gene. The Simplot recombination analysis tool provided congruent results.

The respiratory sample from which the first recombinant genome was obtained was inoculated on Vero E6 cells the day following recombinant identification, and cytopathic effect was observed after 4 days (**Figures 3a, b**). The same day, supernatant was collected and next-generation genome sequencing was performed using Nanopore technology on a GridION instrument after PCR amplification with Artic primers, which allowed obtaining the genome sequence of the viral isolate 8 h later (GISAID accession no. EPI_ISL_10640045). At mutated positions compared to the Wuhan-Hu-1 isolate genome, mean sequencing depth was 2,771 reads and mean prevalence of the majoritary nucleotide was 99.1% (minimum, 95.1%), and the consensus genome was identical to that obtained from the respiratory sample, showing unambiguously that the virus isolated was the Delta 21J/AY.4-Omicron 21K/BA.1 recombinant. Finally, viral particles were observed in the culture supernatant by scanning electron microscopy with a SU5000 microscope within minutes after supernatant collection (**Figure 3c**).

![Figure 3.](http://medrxiv.org/https://www.medrxiv.org/content/medrxiv/early/2022/03/08/2022.03.03.22271812/F3.medium.gif)

[Figure 3.](http://medrxiv.org/content/early/2022/03/08/2022.03.03.22271812/F3)

Figure 3. Microscopy images of the virus cytopathic effect (a, b) and of a viral particle (c) in culture of the SARS-CoV-2 Delta 21J/AY.4-Omicron 21K/BA.1 recombinant on Vero E6 cells.
a. Absence of cytopathic effect (negative control: absence of virus); b. Cytopathic effect observed 4 days post-inoculation on Vero E6 cells of the respiratory sample of the first patient for whom the SARS-CoV-2 Delta 21J/AY.4-Omicron 21K/BA.1 recombinant was identified.

c. Scanning electron microscopy image was obtained with a SU5000 microscope (Hitachi High-Technologies Corporation, Tokyo, Japan).

The overall structure of the recombinant spike protein was predicted (**Figures 4a-c)**. When superimposed with the spike of the Omicron 21K/BA.1 variant, the main structural changes were located in the N-terminal domain (NTD). In this region, the surface of the recombinant spike protein is enlarged, flattened, and more electropositive, a property that is characteristic of the Delta 21J/AY.4 NTD (**Figure 4c**). In the initial interaction of the virus with the plasma membrane of the host cells, the NTD is attracted by lipid rafts, which provides an electronegative landing platforms for the spike (Fantini et al., 2021; Fantini et al., 2022). Thus, an increase in the electrostatic surface of the NTD is expected to accelerate the binding of the virus to lipid rafts, which may confer a selective kinetic advantage against virus competitors (Fantini et al., 2021). The receptor binding domain (RBD) of the recombinant is clearly inherited from the Omicron 21K/BA.1 variant (**Figure 4c**). The consequence is also an increase in the electrostatic surface potential of the RBD, which may facilitate the interaction with the electronegative interface of the ACE-2 cellular receptor. Overall, this structural analysis suggests that the recombinant virus could have been selected on the basis of kinetic properties conferred by a convergent increase of the electrostatic potential of both the NTD and the RBD, together with an enlargement of the NTD surface, all features that suggest an optimization of virus binding to the host cell membrane.

![Figure 4.](http://medrxiv.org/https://www.medrxiv.org/content/medrxiv/early/2022/03/08/2022.03.03.22271812/F4.medium.gif)

[Figure 4.](http://medrxiv.org/content/early/2022/03/08/2022.03.03.22271812/F4)

Figure 4. Schematic of the predicted structure of the spike protein of the SARS-CoV-2 Delta 21J/AY.4-Omicron 21K/BA.1 recombinant
a. Overall structure of the recombinant spike protein. The secondary structure is in grey, mutated amino acids are in blue. NTD, N-terminal domain; RBD, receptor binding domain; S1-S2, cleavage site.

b. Superimposition of the secondary structure of the Omicron 21K/BA.1 variant (in cyan) and recombinant (in red) spike proteins. NTD, N-terminal domain; RBD, receptor binding domain.

c. Comparison of the electrostatic surface potential of the spike proteins in Delta 21J/AY.4 lineage, Omicron 21K/BA.1 variant, and in the recombinant. The color scale (negative in red, positive in blue, neutral in white) is indicated. NTD, N-terminal domain; RBD, receptor binding domain.

Currently used qPCR screening assays were not able to discriminate this Delta 21J/AY.4-Omicron 21K/BA.1 recombinant and the Omicron 21K/BA.1 variant because the Delta variant signature mutation detected is absent from the recombinant genome. Therefore, we attempted to promptly implement a specific qPCR assay that could be used to detect the recombinant for routine diagnosis use. This was achieved in one day by selecting qPCR systems from our toolbox of dozens of in house qPCR systems that were designed since the emergence of the first variant during summer 2020 to specifically target SARS-CoV-2 variants or mutants (Bedotto et al., 2021; Colson et al., 2022b). Two systems that target either the Delta 21J variant or the Omicron BA.1 variant were combined in a duplex qPCR that can screen for the recombinant. In preliminary assessment, both tested recombinant-positive samples were positive for the Delta 21J and Omicron BA.1 targets. In addition, 7 Delta non-21J-positive samples were negative for both targets, 4 Delta 21J-positive samples were positive for the Delta 21J target but negative for the Omicron BA.1 target, and 3 Omicron BA.1-positive samples were negative for the Delta 21J target but positive for the Omicron BA.1 target.

## Discussion

It is increasingly demonstrated that the genomes of most biological entities, whatever their level of complexity, are mosaics of sequences from various origins (Raoult, 2011; Merhej and Raoult, 2012; Feschotte et al., 2012; Roux et al., 2013; Jacobs et al., 2019). The present observations show us in real life the recombination potential of SARS-CoV-2, already largely established for other coronaviruses (Liu et al., 2013; Xiao et al., 2017; Lai, 1996; Zhang et al., 2015; Gribble et al., 2021) and reported or suspected for SARS-CoV-2 (Yi, 2020; Yeh and Contreras, 2020; VanInsberghe et al., 2020; Gallaher, 2020; Jackson et al., 2021; Haddad et al., 2021; Varabyou et al., 2021; Leary et al., 2021; Taghizadeh et al., 2021; Lohrasbi-Nejad, 2022; Kreier, 2022; Ignatieva et al., 2022). SARS-CoV-2 recombinations were difficult to spot when only genetically very similar viruses were circulating, as was the case in Europe during the first epidemic episode with mutants derived from the Wuhan-Hu-1 virus. The increasing genetic diversity of SARS-CoV-2, the tremendous number of infections at global and national levels, and the unprecedented global effort of genomic sequencing ([https://covariants.org/per-country](https://covariants.org/per-country)) (Aksamentov et al., 2022; Hodcroft et al., 2021; Alm et al., 2020; Colson et al., 2022b), raised the probability of detecting recombinants. Such observations will probably make it possible in the short or medium term to assess the recombination rate of SARS-CoV-2, whether there are recombination hotspots, and to what extent recombinations between different variants can generate new viable, and epidemic variants. This questions on the impact of recombinations on viral replication and transmissibility, and on clinical severity, as well as on the virus ability to escape neutralizing antibodies elicited by vaccines or a previous infection. In this view, culture isolation of SARS-CoV-2 recombinants as was carried out here for the first time to our knowledge is of primary importance. This will allow studying their phenotypic properties, among which their replicative capacity in various cell lines, their sensitivity to antibodies, or their genetic evolution *in vitro*. Concurrently, a high level of genomic surveillance must be maintained in order to detect and characterize all recombination events and circulating recombinants, which is a critical scientific and public health issue.

## Data Availability

The dataset generated and analyzed during the current study is available in the GISAID database ([https://www.gisaid.org/](https://www.gisaid.org/)).

[https://www.gisaid.org/](https://www.gisaid.org/) 

## Author contributions

Study conception and design: Philippe Colson, Pierre-Edouard Fournier, Jacques Fantini, Didier Raoult, Bernard La Scola. Materials, data and analysis tools: Philippe Colson, Pierre-Edouard Fournier, Jeremy Delerce, Matthieu Million, Marielle Bedotto, Linda Houhamdi, Nouara Yahi, Jeremy Bayette, Jacques Fantini. Data analyses: Philippe Colson, Pierre-Edouard Fournier, Jeremy Delerce, Marielle Bedotto, Anthony Levasseur, Jacques Fantini, Didier Raoult, Bernard La Scola. Writing of the first draft of the manuscript: Philippe Colson, Jacques Fantini, and Pierre-Edouard Fournier. All authors read, commented on, and approved the final manuscript.

## Funding

This work was supported by the French Government under the “Investments for the Future” program managed by the National Agency for Research (ANR), Méditerranée-Infection 10-IAHU-03; by Région Provence Alpes Côte d’Azur and European funding FEDER PRIMMI (Fonds Européen de Développement Régional-Plateformes de Recherche et d’Innovation Mutualisées Méditerranée Infection), FEDER PA 0000320 PRIMMI; by Hitachi High-Technologies Corporation, Tokyo, Japan; and by the French consortium on surveillance and research on infections with emerging pathogens via microbial genomics (consortium relatif à la surveillance et à la recherche sur les infections à pathogènes EMERgents via la GENomique microbienne EMERGEN; [https://www.santepubliquefrance.fr/dossiers/coronavirus-covid-19/consortium-emergen](https://www.santepubliquefrance.fr/dossiers/coronavirus-covid-19/consortium-emergen)).

## Data availability

The dataset generated and analyzed during the current study is available in the GISAID database ([https://www.gisaid.org/](https://www.gisaid.org/)).

## Conflicts of interest

Didier Raoult has a conflict of interest as having been a consultant for Hitachi High-Technologies Corporation, Tokyo, Japan from 2018 to 2020. He is a scientific board member of Eurofins company and a founder of a microbial culture company (Culture Top). All other authors have no conflicts of interest to declare. Funding sources had no role in the design and conduct of the study; collection, management, analysis, and interpretation of the data; and preparation, review, or approval of the manuscript.

## Ethics

This study has been approved by the ethics committee of the University Hospital Institute Méditerranée Infection (No. 2022-001). Access to the patients’ biological and registry data issued from the hospital information system was approved by the data protection committee of Assistance Publique-Hôpitaux de Marseille (APHM) and was recorded in the European General Data Protection Regulation registry under number RGPD/APHM 2019-73.

## Acknowledgments

We are very grateful to Clio Grimaldier, Rita Zgheib, Claudia Andrieu, Ludivine Bréchard, and Raphael Tola for their technical help.

*   Received March 3, 2022.
*   Revision received March 3, 2022.
*   Accepted March 8, 2022.


*   © 2022, Posted by Cold Spring Harbor Laboratory

This pre-print is available under a Creative Commons License (Attribution 4.0 International), CC BY 4.0, as described at [http://creativecommons.org/licenses/by/4.0/](http://creativecommons.org/licenses/by/4.0/)

## REFERENCES

1.  Aksamentov I, Roemer C, Hodcroft EB, Neher RA. Nextclade: clade assignment, mutation calling and quality control for viral genomes. Zenodo 2021. doi: [https://doi.org/10.5281/zenodo.5607694](https://doi.org/10.5281/zenodo.5607694).
    
    

2.  Alm E, Broberg EK, Connor T, Hodcroft EB, Komissarov AB, Maurer-Stroh S, Melidou A, Neher RA, O’Toole Á, Pereyaslov D; WHO European Region sequencing laboratories and GISAID EpiCoV group; WHO European Region sequencing laboratories and GISAID EpiCoV group. Geographical and temporal distribution of SARS-CoV-2 clades in the WHO European Region, January to June 2020. Euro Surveill. 2020 Aug;25(32):2001410.
    
    

3.  Bedotto M, Fournier PE, Houhamdi L, Colson P, Raoult D. Implementation of an in-house real-time reverse transcription-PCR assay to detect the emerging SARS-CoV-2 N501Y variants. J Clin Virol. 2021;140:104868.
    
    

4.  Bentley K, Evans DJ. Mechanisms and consequences of positive-strand RNA virus recombination. J Gen Virol. 2018;99:1345–1356.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1099/jgv.0.001142&link_type=DOI) 
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=30156526&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

5.  Colson P, Delerce J, Beye M, Levasseur A, Boschi C, Houhamdi L, Tissot-Dupont H, Yahi N, Million M, La Scola B, Fantini J, Raoult D, Fournier PE. First cases of infection with the 21L/BA.2 Omicron variant in Marseille, France. medRxiv 2022a; 2022.02.08.22270495; doi: [https://doi.org/10.1101/2022.02.08.22270495](https://doi.org/10.1101/2022.02.08.22270495).
    
    

6.  Colson P, Fournier PE, Chaudet H, Delerce J, Giraud-Gatineau A, Houhamdi L, Andrieu C, Brechard L, Bedotto M, Prudent E, Gazin C, Beye M, Burel E, Dudouet P, Tissot-Dupont H, Gautret P, Lagier JC, Million M, Brouqui P, Parola P, Fenollar F, Drancourt M, La Scola B, Levasseur A, Raoult D. Analysis of SARS-CoV-2 variants from 24,181 patients exemplifies the role of globalization and zoonosis in pandemics. Front Microbiol. 2022b;12:786233.
    
    

7.  Colson P, Lagier JC, Baudoin JP, Bou Khalil J, La Scola B, Raoult D. Ultrarapid diagnosis, microscope imaging, genome sequencing, and culture isolation of SARS-CoV-2. Eur J Clin Microbiol Infect Dis. 2020 Aug;39(8):1601–1603.
    
    

8.  Fantini J, Yahi N, Colson P, Chahinian H, La Scola B, Raoult D. The puzzling mutational landscape of the SARS-2-variant Omicron. J Med Virol 2022 Jan 8. doi: 10.1002/jmv.27577. Epub ahead of print.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1002/jmv.27577&link_type=DOI) 

9.  Fantini J, Yahi N, Azzaz F, Chahinian H. Structural dynamics of SARS-CoV-2 variants: A health monitoring strategy for anticipating Covid-19 outbreaks. J Infect 2021;83:197–206.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1016/j.jinf.2021.06.001&link_type=DOI) 

10. Feschotte C, Gilbert C. Endogenous viruses: insights into viral evolution and impact on host biology. Nat Rev Genet. 2012;13:283–96.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1038/nrg3199&link_type=DOI) 
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=22421730&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

11. Francisco RDS Jr., Benites LF, Lamarca AP, de Almeida LGP, Hansen AW, Gularte JS, Demoliner M, Gerber AL, de CGuimarães AP, Antunes AKE, Heldt FH, Mallmann L, Hermann B, Ziulkoski AL, Goes V, Schallenberger K, Fillipi M, Pereira F, Weber MN, de Almeida PR, Fleck JD, Vasconcelos ATR, Spilki FR. Pervasive transmission of E484K and emergence of VUI-NP13L with evidence of SARS-CoV-2 co-infection events by two different lineages in Rio Grande do Sul, Brazil. Virus Res. 2021;296:198345.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1016/j.virusres.2021.198345&link_type=DOI) 

12. Gallaher WR. A palindromic RNA sequence as a common breakpoint contributor to copy-choice recombination in SARS-COV-2. Arch Virol. 2020;165:2341–2348.
    
    

13. Gribble J, Stevens LJ, Agostini ML, Anderson-Daniels J, Chappell JD, Lu X, Pruijssers AJ, Routh AL, Denison MR. The coronavirus proofreading exoribonuclease mediates extensive viral recombination. PLoS Pathog. 2021;17(1):e1009226.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1371/journal.ppat.1009226&link_type=DOI) 

14. Haddad D, John SE, Mohammad A, Hammad MM, Hebbar P, Channanath A, Nizam R, Al-Qabandi S, Al Madhoun A, Alshukry A, Ali H, Thanaraj TA, Al-Mulla F. SARS-CoV-2: Possible recombination and emergence of potentially more virulent strains. PLoS One. 2021;16:e0251368.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1371/journal.pone.0251368&link_type=DOI) 

15. Hadfield J, Megill C, Bell SM, Huddleston J, Potter B, Callender C, Sagulenko P, Bedford T, Neher RA. Nextstrain: real-time tracking of pathogen evolution. Bioinformatics. 2018;34:4121–4123.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10/gdkbqx&link_type=DOI) 
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=http://www.n&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

16. Hodcroft EB, Zuber M, Nadeau S, Vaughan TG, Crawford KHD, Althaus CL, Reichmuth ML, Bowen JE, Walls AC, Corti D, Bloom JD, Veesler D, Mateo D, Hernando A, Comas I, González Candelas F; SeqCOVID-SPAIN consortium, Stadler T, Neher RA. Emergence and spread of a SARS-CoV-2 variant through Europe in the summer of 2020. Nature. 2021;595:707–712.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1101/2020.10.25.20219063&link_type=DOI) 

17. Houhamdi L, Gautret P, Hoang VT, Fournier PE, Colson P, Raoult D. Characteristics of the first 1119 SARS-CoV-2 Omicron variant cases, in Marseille, France, November-December 2021. J Med Virol. 2022 Jan 20. doi: 10.1002/jmv.27613. Epub ahead of print.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1002/jmv.27613&link_type=DOI) 

18. Hodcroft E. 2012. CoVariants: SARS-CoV-2 mutations and variants of interest. Available from: [https://covariants.org/](https://covariants.org/).
    
    

19. Ignatieva A, Hein J, Jenkins PA. Ongoing recombination in SARS-CoV-2 revealed through genealogical reconstruction. Mol Biol Evol. 2022;39:msac028.
    
    

20. Jackson B, Boni MF, Bull MJ, Colleran A, Colquhoun RM, Darby AC, Haldenby S, Hill V, Lucaci A, McCrone JT, Nicholls SM, O’Toole Á, Pacchiarini N, Poplawski R, Scher E, Todd F, Webster HJ, Whitehead M, Wierzbicki C; COVID-19 Genomics UK (COG-UK) Consortium, Loman NJ, Connor TR, Robertson DL, Pybus OG, Rambaut A. Generation and transmission of interlineage recombinants in the SARS-CoV-2 pandemic. Cell. 2021;184:5179–5188.e8.
    
    

21. Jacobs GS, Hudjashov G, Saag L, Kusuma P, Darusallam CC, Lawson DJ, Mondal M, Pagani L, Ricaut FX, Stoneking M, Metspalu M, Sudoyo H, Lansing JS, Cox MP. Multiple deeply divergent Denisovan ancestries in Papuans. Cell. 2019;177:1010–1021.e32.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1016/j.cell.2019.02.035&link_type=DOI) 
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=30981557&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

22. Kreier F. Deltacron: the story of the variant that wasn’t. Nature. 2022;602:19.
    
    

23. La Scola B, Le Bideau M, Andreani J, Hoang VT, Grimaldier C, Colson P, Gautret P, Raoult D. Viral RNA load as determined by cell culture as a management tool for discharge of SARS-CoV-2 patients from infectious disease wards. Eur J Clin Microbiol Infect Dis. 2020;39:1059–1061.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1007/sl0096-020-03913-9&link_type=DOI) 
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=http://www.n&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

24. Lai MMC. Recombination in large RNA viruses: Coronaviruses. Semin Virol. 1996;7:381–388.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1006/smvy.1996.0046&link_type=DOI) 

25. Leary S, Gaudieri S, Parker MD, Chopra A, James I, Pakala S, Alves E, John M, Lindsey BB, Keeley AJ, Rowland-Jones SL, Swanson MS, Ostrov DA, Bubenik JL, Das S, Sidney J, Sette A; COVID-19 Genomics UK (COG-UK) consortium, de Silva TI, Phillips E, Mallal S. Generation of a novel SARS-CoV-2 sub-genomic RNA due to the R203K/G204R variant in nucleocapsid: homologous recombination has potential to change SARS-CoV-2 at both protein and RNA level. Pathog Immun. 2021;6:27–49.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.20411/pai.v6i2.460&link_type=DOI) 

26. Lemey P, Ruktanonchai N, Hong SL, Colizza V, Poletto C, Van den Broeck F, Gill MS, Ji X, Levasseur A, Oude Munnink BB, Koopmans M, Sadilek A, Lai S, Tatem AJ, Baele G, Suchard MA, Dellicour S. Untangling introductions and persistence in COVID-19 resurgence in Europe. Nature. 2021;595:713–717.
    
    

27. Liu X, Shao Y, Ma H, Sun C, Zhang X, Li C, Han Z, Yan B, Kong X, Liu S. Comparative analysis of four Massachusetts type infectious bronchitis coronavirus genomes reveals a novel Massachusetts type strain and evidence of natural recombination in the genome. Infect Genet Evol. 2013;14:29–38.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1016/j.meegid.2012.09.016&link_type=DOI) 

28. Lohrasbi-Nejad A. Detection of homologous recombination events in SARS-CoV-2. Biotechnol Lett. 2022 Jan 17:1–16. doi: 10.1007/s10529-021-03218-7. Epub ahead of print.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1007/s10529-021-03218-7&link_type=DOI) 

29. Makarenkov V, Mazoure B, Rabusseau G, Legendre P. Horizontal gene transfer and recombination analysis of SARS-CoV-2 genes helps discover its close relatives and shed light on its origin. BMC Ecol Evol. 2021;21:5.
    
    

30. Merhej V, Raoult D. Rhizome of life, catastrophes, sequence exchanges, gene creations, and giant viruses: how microbial genomics challenges Darwin. Front Cell Infect Microbiol. 2012;2:113.
    
    

31. Rambaut A, Holmes EC, O’Toole Á, Hill V, McCrone JT, Ruis C, du Plessis L, Pybus OG. A dynamic nomenclature proposal for SARS-CoV-2 lineages to assist genomic epidemiology. Nat Microbiol. 2020;5:1403–1407.
    
    

32. Raoult D. A viral grandfather: genomics in 2010 contradict Darwin’s vision of evolution. Eur J Clin Microbiol Infect Dis. 2011;30:935–6.
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=21618022&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

33. Rockett, Jenny Draper,  Mailie Gall,  Eby M Sim,  Alicia Arnott,  Jessica E Agius,  Jessica Johnson-Mackinnon,  Elena Martinez,  Alexander P Drew,  Clement Lee,  Christine Ngo,  Marc Ramsperger,  Andrew N Ginn,  Qinning Wang,  Michael Fennell,  Danny Ko,  Linda Huston,  Lukas Kairaitis,  Edward C Holmes,  Matthew N O’Sullivan,  Sharon C-A Chen,  Jen Kok,  Dominic E Dwyer,  Vitali Sintchenko. Co-infection with SARS-CoV-2 Omicron and Delta Variants revealed by genomic surveillance. medRxiv 2022; 2022.02.13.22270755; doi: [https://doi.org/10.1101/2022.02.13.22270755](https://doi.org/10.1101/2022.02.13.22270755).
    
    

34. Roux S, Enault F, Bronner G, Vaulot D, Forterre P, Krupovic M. Chimeric viruses blur the borders between the major groups of eukaryotic single-stranded DNA viruses. Nat Commun. 2013;4:2700.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1038/ncomms3700&link_type=DOI) 
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=24193254&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

35. So RTY, Chu DKW, Miguel E,  Perera Rapm, Oladipo JO, Fassi-Fihri O, Aylet G, Ko RLW, Zhou Z, Cheng MS, Kuranga SA, Roger FL, Chevalier V, Webby RJ, Woo PCY, Poon LLM, Peiris M. Diversity of dromedary camel coronavirus HKU23 in African camels revealed multiple recombination events among closely related betacoronaviruses of the subgenus Embecovirus. J Virol. 2019;93:e01236–19.
    
    

36. Taghizadeh P, Salehi S, Heshmati A, Houshmand SM, InanlooRahatloo K, Mahjoubi F, Sanati MH, Yari H, Alavi A, Jamehdar SA, Dabiri S, Galehdari H, Haghshenas MR, Hashemian AM, Heidarzadeh A, Jahanzad I, Kheyrani E, Piroozmand A, Mojtahedi A, Nikoo HR, Rahimi Bidgoli MM, Rezvani N, Sepehrnejad M, Shakibzadeh A, Shariati G, Seyyedi N, MohammadSaleh Zahraei S, Safari I, Elahi E. Study on SARS-CoV-2 strains in Iran reveals potential contribution of co-infection with and recombination between different strains to the emergence of new strains. Virology. 2021;562:63–73.
    
    

37. van Dorp L, Richard D, Tan CCS, Shaw LP, Acman M, Balloux F. No evidence for increased transmissibility from recurrent mutations in SARS-CoV-2. Nat Commun. 2020;11:5986.
    
    

38. VanInsberghe D, Neish AS, Lowen AC, Koelle K. Recombinant SARS-CoV-2 genomes are currently circulating at low levels. bioRxiv 2021;2020.08.05.238386. doi: 10.1101/2020.08.05.238386.
    
    [Abstract/FREE Full Text](http://medrxiv.org/lookup/ijlink/YTozOntzOjQ6InBhdGgiO3M6MTQ6Ii9sb29rdXAvaWpsaW5rIjtzOjU6InF1ZXJ5IjthOjQ6e3M6ODoibGlua1R5cGUiO3M6NDoiQUJTVCI7czoxMToiam91cm5hbENvZGUiO3M6NzoiYmlvcnhpdiI7czo1OiJyZXNpZCI7czoxOToiMjAyMC4wOC4wNS4yMzgzODZ2MiI7czo0OiJhdG9tIjtzOjUwOiIvbWVkcnhpdi9lYXJseS8yMDIyLzAzLzA4LzIwMjIuMDMuMDMuMjIyNzE4MTIuYXRvbSI7fXM6ODoiZnJhZ21lbnQiO3M6MDoiIjt9) 

39. Varabyou A, Pockrandt C, Salzberg SL, Pertea M. Rapid detection of inter-clade recombination in SARS-CoV-2 with Bolotie. Genetics. 2021;218:iyab074.
    
    

40. Xiao Y, Rouzine IM, Bianco S, Acevedo A, Goldstein EF, Farkov M, Brodsky L, Andino R. RNA recombination enhances adaptability and is required for virus spread and virulence. Cell Host Microbe. 2017;22:420.
    
    [CrossRef](http://medrxiv.org/lookup/external-ref?access_num=10.1016/j.chom.2017.08.006&link_type=DOI) 
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=28910639&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

41. Yeh TY, Contreras GP. Emerging viral mutants in Australia suggest RNA recombination event in the SARS-CoV-2 genome. Med J Aust. 2020;213:44–44.e1.
    
    [PubMed](http://medrxiv.org/lookup/external-ref?access_num=http://www.n&link_type=MED&atom=%2Fmedrxiv%2Fearly%2F2022%2F03%2F08%2F2022.03.03.22271812.atom) 

42. Yi H. 2019 Novel coronavirus is undergoing active recombination. Clin Infect Dis. 2020;71:884–887.
    
    

43. Zhang Y, Li J, Xiao Y, Zhang J, Wang Y, Chen L, Paranhos-Baccalà G, Ren L, Wang J. Genotype shift in human coronavirus OC43 and emergence of a novel genotype by natural recombination. J Infect. 2015;70:641–50.