LAMP-BEAC: Detection of SARS-CoV-2 RNA Using RT-LAMP and Molecular Beacons

Designing molecular beacons for SARS-CoV-2 RT-LAMP

Several beacons were tested for detection of SARS-CoV-2 RNA in RT-LAMP reactions (Table S1). Optimization required identifying sequence designs that performed properly under the conditions of the RT-LAMP reaction, which is typically run at temperatures around 65°C. Function of the beacon requires that the hairpin remain mostly folded in the hairpin structure at this temperature, while still opening sufficiently often to allow annealing to the target RT-LAMP cDNA product. The annealed beacon-target cDNA duplex must then be sufficiently stable at 65°C to result in unquenching and an increase in fluorescence. To increase beacon affinity for use at higher temperatures, we substituted multiple dNTP positions within the target sequence of each beacon with locked nucleic acids [14]. Locked nucleic acids reduce the conformational flexibility of dNTPs and make the free energy of nucleic acid annealing more favorable [16]. Several beacons were tested for performance using previously reported RT-LAMP amplicons (Table S1).

Testing LAMP-BEAC

An example of a successful beacon design is Penn-LF-beac (Table S1). The RT-LAMP amplicon targets the orf1ab coding region and was first reported by El-Tholoth and coworkers at the University of Pennsylvania (“Penn”)[8]. The favored beacon was designed to target sequences within the forward DNA loop generated during LAMP; thus the beacon is designated Penn loop forward beacon, contracted to Penn-LF-beac.

Figure 2 shows use of the Penn-LF-beac system to detect synthetic SARS-CoV-2 RNA. Tests were carried out with commercial LAMP polymerase and reverse transcriptase preparations. In addition, to avoid possible supply chain problems and allow potential production of reagents in resource limited settings, we produced and purified novel DNA polymerase and reverse transcriptase enzymes, which were assayed in parallel with commercial preparations for some tests (described below).

• Download figure
• Open in new tab

Fig. 2.

Reaction progression curves comparing RT-LAMP assayed using an intercalating dye and LAMP-BEAC. A) Conventional RT-LAMP assay detecting SARS-CoV-2 RNA. Time after reaction initiation is shown on the x-axis, relative fluorescence intensity is shown on the y-axis. The RNA used was the Twist commercial positive control; copy numbers in the reaction mixture are shown in the key at the bottom. B) Detection of SARS-CoV-2 RNA using LAMP-BEAC. Markings are as in A). C) and D) Thermal melting curves to characterize amplification products. The results shown are for reactions in A and B; the key to samples tested is at the bottom. Reaction products were cooled to room temperature, then slowly heated for the melt curve analysis. C) Characterization of products generated using conventional RT-LAMP and the Twist RNA template. The x-axis shows the temperature, the y-axis shows fluorescence intensity. D) Characterization of products generated using LAMP-BEAC. Markings as in A).

To compare standard LAMP amplification with LAMP-BEAC, reactions were prepared containing both the SYTO 9 fluorescent dye (Fig. 2A), which detects bulk DNA by intercalation, and the Penn-LF-beac (Fig. 2B). Reaction products were detected at two wavelengths, allowing separate quantification of the bulk dye and the molecular beacon in single reactions. The standard RT-LAMP showed bulk DNA production at shorter times than with the water control, but the water control did amplify shortly after the positive samples. This spurious late amplification is commonly seen with RT-LAMP, though the mechanism is unclear. The primers may interact with each other to form products and launch amplification, or perhaps the reaction results from amplification of adventitious environmental DNA. In separate tests, synthesis of DNA products was shown to depend on addition of LAMP primers (data not shown).

Reactions detected with the Penn-LF-beac showed more clear-cut discrimination (Fig. 2B). The positive samples showed positive signal after about the same amount of time as for the conventional RT-LAMP. However, no signal was detected for the negative water control. Lack of amplification in negative controls has been reproducible over multiple independent reactions (examples below).

The nature of the products could be assessed using thermal denaturation (Fig. 2C and D). Reactions were first cooled to allow full annealing of complementary DNA strands, then slowly heated while recording fluorescence intensity. The fluorescent signal of the intercalating dye started high but dropped with increasing temperature in all samples (Fig. 2C), consistent with denaturation of the duplex and release of the intercalating dye into solution. In contrast, the beacon’s fluorescent signal in the water controls started at low fluorescence (Fig. 2D), consistent with annealing of the beacon DNA termini to form the hairpin structure (Fig. 1). At temperatures above 70°C the fluorescence modestly increased, consistent with opening of the hairpin and reptation of the beacon as a random coil in solution. For reactions containing the RT-LAMP product and Penn-LF-beac, fluorescence values were high at lower temperatures, consistent with formation of the annealed duplex, then at temperature sufficient for denaturation, the fluorescence values fell to match those of the random coil (Fig. 2D). Thus the LAMP-BEAC assay generates strong fluorescence signals during LAMP amplification in the presence of target RNA but not in negative controls, and the thermal melting properties are consistent with formation of the expected products.

Multiplex LAMP-BEAC assays

We next sought to develop additional LAMP-BEAC assays to allow multiplex detection of SARS-CoV-2 RNA, and to allow parallel analysis of human RNA controls as a check on sample integrity, and so developed several additional beacons (Supplementary Table 1). E1-LB-beac recognizes an amplicon targeting the viral E gene reported in [17], and As1e-LB-beac recognizes the SARS-CoV-2 As1e amplicon reported in [9] targeting the orf1ab coding region. We also developed a positive control beacon, STATH-LB-beac, to detect a LAMP amplicon targeting the human STATH mRNA (Supplementary Table 1). STATH was chosen because it is abundantly expressed in human saliva, and a tested RT-LAMP amplicon was available [18].

To allow independent detection of each amplicon as a quadruplex assay, each beacon was labeled using fluorophores with different wavelengths of maximum emission. E1-LB-beac was labeled with FAM and detected at 520 nm, STATH-LB-beac was labeled with hexachlorofluorescein (Hex) and detected at 587 nm, As1e-LB-beac was labeled with Tex615 and detected at 623 nm, and Penn-LF-beac was labeled with cyanine-5 (Cy5) and detected at 682 nm.

As an example, the quadruplex LAMP-BEAC assay was tested with contrived samples, in which saliva was doped with synthetic SARS-CoV-2 RNA (Fig. 3). Prior to dilution, saliva was treated with TCEP and EDTA, followed by heating at 95°C, which inactivates both SARS-CoV-2 and cellular RNases[9], and so is part of our sample processing pipeline. The STATH-LB-beac amplicon detected the human RNA control in all saliva samples (Fig. 3A).The E1-LB-beac amplicon consistently detected SARS-CoV-2 RNA down to ∼250 copies per reaction (Fig. 3B), and the As1e-LB-beac amplicon detected SARS-CoV-2 RNA to ∼250 copies per reaction (Fig. 3C). The Penn-LF-beac amplicon was least sensitive, detecting SARS-CoV-2 RNA consistently only at ∼1000 copies per reaction (Fig. 3D); thus the Penn-LF-beac assay reports particularly high numbers of RNA copies.

• Download figure
• Open in new tab

Fig. 3.

A multiplex LAMP-BEAC method assaying four amplicons. Assays were carried out using a LAMP-BEAC amplicon to detect human STATH RNA (A) and three amplicons to detect SARS-CoV-2 (B-D). For these assays, synthetic SARS-CoV-2 RNA was diluted into saliva (inactivated as described[9]); copies per microliter are shown by the color code in the lower right. For A-D, the x-axis shows time after starting the assay, and the y-axis shows fluorescence intensity. E-H shows melt curve analysis for samples in A-D. For E-H, the x-axis shows temperature, and the y-axis shows fluorescence intensity.

Melt curve analysis was also carried out (Fig. 3 E-H). Melt curve profiles were distinctive for each beacon, but the overall pattern included high fluorescence in the positive samples and low values in negative samples at lower temperatures, then convergence of positive and negative samples at high temperatures associated with full melting of the beacon and reptation in solution. The melt curve data for each beacon supported correct function and the expected structures of the amplification products.

Assessing LAMP-BEAC performance on clinical saliva samples

We next tested the LAMP-BEAC assay on a set of 20 saliva samples collected during surveillance for potential SARS-CoV-2 infection. Samples were from a clinical sample acquisition site, where subjects were tested by clinical nasopharyngeal (NP) swabbing and RT-qPCR, and also donated saliva for comparison. As controls, two fresh saliva samples were collected at the time of assay, and two negative controls containing water only were compared. Saliva samples were treated with TCEP and EDTA, and heated at 95°C for five minutes to inactivate RNase and SARS-CoV-2 [9]. As an additional check, RNA was purified from the same set of saliva samples and RT-qPCR carried out using a CDC-recommend primer set, allowing investigation of possible differences between NP swabs and saliva as analytes.

The LAMP reaction was carried out using a multiplex with two SARS-CoV-2 LAMP-BEAC assays, As1e-LB-beac and Penn-LF-beac, or As1e-beac along with the human RNA-targeted STATH-LB-beac as a measure of sample integrity. Bulk DNA synthesis was also monitored using SYTO 9. The sample set was assayed twice to allow comparison of technical replicates (Figure S1). Melt curve analysis of the amplification products was consistent with the expected molecular structures as described above (Figure S1). Bulk DNA amplification was seen in all samples (Figure S1).

Figure 4 compares the final maximum fluorescence values in the LAMP-BEAC assays to RT-qPCR quantitation on the same saliva samples. Of the clinical saliva samples, 19/22 were positive for the STATH RNA control. Three failed for unknown reasons. We note that the clinical samples had been stored for some time and frozen and thawed more than once, possibly leading to RNA degradation. The two fresh saliva samples were both positive for STATH RNA.

• Download figure
• Open in new tab

Fig. 4.

Validation of multiplexed LAMP-BEAC on 20 clinical samples using multiplexed assays. A) and B) Fluorescence was measured after an hour of LAMP amplification and the maximum endpoint fluorescence observed in any amplification for As1e (A) or Penn (B) lamp primers (y-axis) was compared to previously measured qPCR measurements of SARS-CoV-2 copy number from the same samples (x-axis). Vertical dotted line indicates 100 copies/μl corresponding to approximately 10,000 RNA copies/ml in the unpurified NP swab eluate. Horizontal dashed line indicates a potential LAMP cutoff of two times the highest fluorescence seen in uninfected saliva controls. C) In the same LAMP reactions, the fluorescence of human STATH gene targeted LAMP beacons was measured and the maximum endpoint value observed compared to those seen in water controls. Dashed line indicates two times the highest fluorescence seen in the water controls.

Ten of the saliva samples were called positive for SARS-CoV-2 RNA. The fresh SARS-CoV-2 negative saliva samples and the water controls were called negative as expected. Comparing the 10 positive samples to RT-qPCR on saliva showed that all samples with RT-qPCR calls of 100 or more viral RNA copies per microliter of saliva were identified as positive. An independent replication of the assay in another laboratory using LAMP-BEAC to analyze the same samples yielded closely similar results (Supplementary Table S2). Thus the RT-qPCR assay and LAMP-BEAC on saliva samples showed excellent agreement for the higher copy number samples.

We then performed a quadruplex LAMP-BEAC, using Penn-LF-beac, E1-LB-beac, As1e-LB-beac and STATH-LB-beac, on these 20 samples plus an additional 56 saliva samples and compared our results to clinical RT-qPCR on NP swabs obtained from the same patients to assess performance. If we assume the results from NP swabs represent truth then the LAMP-BEAC had a sensitivity of 0.57 and a specificity of 0.98. The great majority of disagreements between LAMP-BEAC and clinical assay corresponded to samples with low estimated copy numbers. For example, LAMP-BEAC detected all 10 samples with a RT-qPCR estimated copies per μl >1000. Thus the LAMP-BEAC assays correlated perfectly with RT-qPCR on the same saliva samples at high RNA copies. Notably, the single saliva sample called positive by LAMP-BEAC but negative by clinical NP assay was also estimated at 2×10⁵ viral RNA copies/μl by RT-qPCR. A recent study has documented differences between the loads of SARS-CoV-2 RNA at different body sites [19], including oral and nasal sites, potentially accounting at least in part for the observed differences.

We note that the detection shown in Figure 4, using end point fluorescence values and not reaction progression curves, offers a simplified read out of reaction results. That is, advanced qPCR machines are not needed for quantification of product formation using LAMP-BEAC, but rather reaction end points can be used to read out results using a simpler fluorescent plate reader. This may help with bypassing possible supply chain bottlenecks associated with purchasing qPCR machines for SARS-CoV-2 assays.

Laboratory-based production of polymerases required for RT-LAMP

Polymerase enzymes are expensive and potentially subject to supply chain disruptions, so we engineered novel reverse transcriptase and DNA polymerase enzymes and devised simple purification protocols, allowing inexpensive local production of the required enzymes. HIV-2 reverse transcriptase and the polA large fragment from Geobacillus stearothermophilus were each engineered to contain several amino acid substitutions expected to stabilize enzyme folding at higher temperatures (RT) or improve strand displacement activity (Bst). Enzymes were purified and tested as described in the methods. Figure S2 summarizes results of side-by-side assays using lab-purified polymerases and commercial enzyme preparations, which indicate that our novel polymerase enzymes are at least as efficient as commercial preparations.

Design of Molecular Beacons

Beacons were designed to detect product generated using previously published LAMP primer sets. To design beacons targeting the loop region of the LAMP amplification product, we mapped the FIP and BIP primers to the SARS-CoV-2 genome to find the entire forward and backward loop regions of the amplicon (potentially including regions outside the original LF and LB primers). We then selected GC-rich subsequences within these loops and selected bases for LNA modification based on the predicted change in melting temperature using a stepwise greedy heuristic of consecutively adding the LNA with the highest predicted Tm. Additional nucleotides were then added to the 5’ and 3’ ends to form a hairpin with predicted melting temperature between 60-65 °C. Where possible terminal bases of the target sequence were used as part of the hairpin. To allow easy and relatively affordable synthesis, beacons were kept shorter than 25 nt with 6 locked nucleic acids.

Design and purification of polymerases

We initially chose the D422A mutant of the polA large fragment from Geobacillus stearothermophilus for LAMP due to its high strand displacement activity [11]. Using strain DSM 13240, the polymerase coding sequence was amplified from genomic DNA, the D422A substitution was incorporated, and the construct was ligated into CDFDuet (Novagen) in-frame with an N-terminal hexahistidine tag. To explore alternative DNA polymerases for LAMP, we generated the R433A and R433P variants, each of which results in disruption of the salt-bridge formed with Asp422 in the wild-type enzyme (pdb 1XWL). The polymerases were expressed in strain BL21(DE3) at 37° for 3 h and purified using Talon (Clontech), heparin sepharose (GE), and MonoQ (GE) chromatography. Purified Bst-LF mutants were concentrated, glycerol added to 10%, and aliquots were flash frozen and stored at −80°C. Primer extension assays using M13 DNA template and ³H-dTTP labeled dNTPs were used to establish specific activity as described for commercially prepared Bst (NEB).

To demonstrate that RT-LAMP can be performed using a reverse transcriptase generated in-house, we first constructed a synthetic gene for the HIV1 RT p66 (strain NL4-3) subunit containing substitutions expected to confer thermal stability (RTx; NEB). The p66 sequence was inserted into pET29b and the p51 subunit coding sequence was amplified by PCR and inserted in frame with an N-terminal hexahistidine tag in CDFDuet. An alternative RT (RT2m) was produced using a similar philosophy with HIV2 RT as the template (Genbank AAB25033), where thirteen naturally occurring substitutions were incorporated. The full-length subunit was inserted into pCDFDuet and the smaller subunit was fused to a C-terminal hexahistidine tag after Thr436 in pETDuet. For both RTs, the subunits were co-expressed in BL21(DE3) and purified using Talon and heparin sepharose chromatography. The purified enzymes were concentrated, glycerol added to 10%, and aliquots were flash frozen and stored at −80°C. Primer extension assays using poly-A template and ³H-labeled dTTP were used to determine specific activity at 50°C as described for commercial RTx (NEB).

RT-LAMP reaction mixtures

RT-LAMP reactions were prepared by mixing 7.5 μl commercial 2x LAMP master mix (NEB E1700L) or our own LAMP mix (40 mM TrisHCl, pH 8.5, 20 mM (NH4)2SO4, 100 mM KCl, 16 mM MgSO4, 0.2% Tween-20, 2.8 mM each dNTP, 16 µg/ml polA LF, and 2.6-7.7 µg/ml RT) with 1.5 μl of 10x primer/beacon master mix (final concentration: 1.6 μM FIP/BIP, 0.2 μM F3/B3, 0.4 μM LF/LB, 0.05 μM beacon) and 6 μl of sample and/or water. For multiplexed LAMP reactions, the final total concentration of primers/beacons was maintained e.g. the individual primer/beacon concentrations were halved when two primer sets were added to the same reaction.

Assays using LAMP-BEAC

LAMP-BEAC reactions were performed at 63-65 °C with fluorescent quantification every 30 seconds on a ThermoFisher QuantStudio 5. Reactions typically completed within 45 minutes but for research purposes data was collected for additional time spans. The synthetic SARS-CoV-2 RNA used as a standard during assay development was obtained from Twist (MT007544.1). After reaction completion, for melt curve analysis, the reaction was heated to 95 °C for 5 minutes to inactivate any remaining enzyme, cooled to 25 °C (at a rate of 0.1 °C/sec) and then slowly heated to 95° C with fluorescence measured every degree.

RT-qPCR to characterize saliva samples

RNA was extracted from ∼140 μl saliva using the Qiagen QIAamp Viral RNA Mini Kit. The RT-qPCR assay used the CDC 2019-nCoV_N1 primer-probe set (2019-nCoV_N1-F: GACCCCAAAATCAGCGAAAT, 2019-nCoV_N1-R: TCTGGTTACTGCCAGTTGAATCTG, 2019_nCoV_N1-P: FAM-ACCCCGCATTACGTTTGGTGGACC-IBFQ). The RT-qPCR master mix contained: 8.5 μl dH2O, 0.5 μl N1-F (20 μM), 0.5 μl N1-R (20 μM), 0.5 μl N1-P (5 μM), 5.0 μl TaqMan™ Fast Virus 1-Step Master Mix per reaction. 5 μl of extracted RNA was added to 15 μl of prepared master mix for a final volume of 20 μl per reaction. Final concentrations of both 2019-nCoV_N1-F and 2019-nCoV_N1-R primers were 500nM and the final concentration of the 2019-nCoV_N1-P probe was 125nM. The assay was performed using the ThermoFisher QuantStudio 5. The thermocycler conditions were: 5 minutes at 50°C, 20 seconds at 95°C, and 40 cycles of 3 seconds at 95°C and 30 seconds at 60°C.