Mortality of COVID-19 is Associated with Cellular Immune Function Compared to Immune Function in Chinese Han Population

Study Design and Participants

This retrospective study was done at Chinese PLA General Hospital, Peking Union Medical College Hospital, and affiliated hospitals of Shanghai University of Medicine & Health Sciences. We extracted 752 case data in Shanghai (338 cases), and Beijing (414 cases) with clinical confirmed COVID-19 from China CDC. 752 case data were enrolled to be finally analyzed. Main symptoms and laboratory characteristics were from 178 patients surveyed by random sampling. This case series was approved by the institutional ethics board of Shanghai University of Medicine & Health Sciences and Peking Union Medical College Hospital (#ZS-1830). 14,117 normal controls from health checkup (from November 2018 to November 2019, before COVID-19 outbreak) in Chinese PLA General Hospital, Peking Union Medical College Hospital, and affiliated hospitals of Shanghai University of Medicine & Health Sciences were retrospectively enrolled. Identification of patients was achieved by reviewing and analyzing available electronic medical records and patient care resources. Written informed consent was waived due to the rapid emergence of this infectious disease. We retrospectively analyzed patients according to WHO interim guidance.¹³ Laboratory confirmation of SARS-CoV-2 infection was performed as previously described.¹⁴

All patients with SARS-CoV-2 pneumonia enrolled in this study were diagnosed according to World Health Organization interim guidance.¹³ According to World Health Organization interim guidance on January 12, 2020, SARS-CoV-2 infection is classified as asymptomatic cases, mild and severe cases of pneumonia, and critical cases of pneumonia (ARDS, sepsis, septic shock). Severe case of pneumonia is defined as patients with respiratory rate > 30 breaths/min, severe respiratory distress, or SpO₂ < 90% on room air.¹⁰ Clinical outcomes (discharges, mortality, and recovery, etc.) were monitored up to March 4, 2020, the final date of follow-up.

Real-Time Reverse Transcription Polymerase Chain Reaction Assay for SARS-CoV-2

A confirmed case of COVID-19 is defined as a positive result on high throughput sequencing or real-time reverse-transcriptase–polymerase-chain-reaction (RT-PCR) assay of pharyngeal swab specimens. Samples were collected for extracting SARS-CoV-2 RNA from patients suspected of having SARS-CoV-2 infection as described previously.¹⁴ In brief, the pharyngeal swabs were placed into a collection tube with 150 μL of virus preservation solution, and total RNA was extracted within 2 hours using the respiratory sample RNA isolation kit. Forty μL of cell lysates were transferred into a collection tube followed by vortex for 10 seconds. After standing at room temperature for 10 minutes, the collection tube was centrifugated at 1000 rpm/min for 5 minutes. The suspension was used for RT-PCR assay of SARS-CoV-2 RNA. Two target genes, including open reading frame 1ab (ORF1ab) and nucleocapsid protein (N), were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; and the probe 5′-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3′. Target 2 (N): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; and the probe 5′-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3′. The real-time RT-PCR assay was performed using a SARS-CoV-2 nucleic acid detection kit. Reaction mixture contains 12 μL of reaction buffer, 4 μL of enzyme solution, 4 μL of probe primers solution, 3 μL of diethyl pyrocarbonate–treated water, and 2 μL of RNA template. RT-PCR assay was performed under the following conditions: incubation at 50 °C for 15 minutes and 95 °C for 5 minutes, 40 cycles of denaturation at 94 °C for 15 seconds, and extending and collecting fluorescence signal at 55 °C for 45 seconds. A cycle threshold value (Ct-value) less than 37 was defined as a positive test result, and a Ct-value of 40 or more was defined as a negative test. These diagnostic criteria were based on the recommendation by the National Institute for Viral Disease Control and Prevention (China). A medium load, defined as a Ct-value of 37 to less than 40, required confirmation by retesting. Only RT-PCR confirmed cases were included in the analysis.

Flow Cytometry Data Analysis

All antibodies were obtained from BD Biosciences (San Jose, CA, USA). Two 100-μL samples of blood were placed in two tubes for staining according to mmanufacturer’s manual. After this procedure, 1 mL of red-cell lyses buffer was added to each tube and incubated for 10 minutes and then washed with Sorvall cell washer (Thermo Fisher Scientific, Waltham, MA, USA). Cells were then resuspended in 350 μL of phosphate-buffered saline and acquired with the use of FACSCanto™ flow cytometry; daily quality control and assurance were carried out with the use of seven-color setup beads (BD Bioscience, San Jose, CA, USA).

Statistical Analysis

Categorical variables were described as frequency rates and percentages, and continuous variables were described using mean, median, and interquartile range (IQR) values. Means for continuous variables were compared using independent group t tests when the data were normally distributed; otherwise, the Mann-Whitney test was used. Data (non-normal distribution) from repeated measures were compared using the generalized linear mixed model. Proportions for categorical variables were compared using the χ² test, although the Fisher exact test was used when the data were limited. All statistical analyses were performed using SPSS (Statistical Package for the Social Sciences) version 13.0 software (SPSS Inc). For unadjusted comparisons, a 2-sided α of less than 0.05 was considered statistically significant. The analyses have not been adjusted for multiple comparisons and, given the potential for type I error, the findings should be interpreted as exploratory and descriptive. Because the cohort of patients in our study was not derived from random selection, all statistics are deemed to be descriptive only.

Presenting Characteristics

The study population included 752 cases with confirmed SARS-CoV-2 pneumonia and 14,117 normal controls. Fever was present in 86-90% of the patients. The second most common symptom was cough (49.1-51.0%), fatigue (25.2-27.1%), sputum (20.0-23.1%), and headache (9.8-11.1%) (Table 1). Less common symptoms were chill, sore throat, shortness of breath, anorexia, diarrhea, nausea, and vomiting.

The COVID-19 mortality rate in China is 2.3%.⁶ However, the mortality rate is 4.6% (2,282 death cases in 49,540 confirmed cases)in Wuhan, 1.9% (8 death cases in 414 confirmed cases) in Beijing, and 0.9% (3 death cases in 338 confirmed cases) in Shanghai based on China CDC official report on March 4, 2020. Our findings showed that the levels of lymphocytes were 0.8(IQR, 0.6-1.1)10⁹/L in Wuhan,³ 1.0(IQR, 0.7-1.4)10⁹/L in Beijing, and 1.1 (IQR, 0.8-1.5) 10⁹/L in Shanghai before admission to hospitals (Table 1), respectively, indicating that cellular immune function might relate to the mortality.

Radiologic and Laboratory Parameters in Mild and Severe or Critical Patients

The radiologic and laboratory findings were showed (Table 1). These data could helpfully distinguish between mild and severe or critical patients. All of the 752 enrolled patients showed bilateral patchy patterns, or ground-glass opacity, or local patchy shadowing of chest CT scan. On admission, the predominant pattern of abnormality observed was bilateral patchy patterns (49.3%), local patchy shadowing (29.0%), and ground glass opacity (21.7%).

Due to lack of reference ranges for blood routine and lymphocytes of normal Chinese Han population, we systematically analyzed the 14,117 healthy adult Chinese Han people of 18-86 years old and classified them as an age group every 10 years for the convenience of other researchers in the future (Table 2).

The reference ranges of lymphocyte subsets are as followings (Table 2): CD3⁺ lymphocytes (938-1835 cells/mm³), CD4⁺ lymphocytes (530-857 cells/mm³), CD8⁺ lymphocytes (348-621 cells/mm³), CD4/CD8 ratio (1.24-2.09), CD19⁺ lymphocytes (166-304 cells/mm³), and CD16⁺CD56⁺ lymphocytes (180-304 cells/mm³). As the age increases,the levels of CD4 lymphocytes, CD8 lymphocytes, and B lymphocytes were decreased, whereas, the levels of natural killer (NK) cells were elevated in Chinese Han population suggesting that the T and B cell immune functions decline with age (Table 2).

The phenomenon of lymphocyte depletion (PLD) observed in severe or critical cases (ICU) in 100% (Table 3). As the disease progressed and clinical status deteriorated, the levels of lymphocytes progressively decreased before death. Further analyzing 178 cases without glucocorticoid treatment, their lymphocyte subsets showed that CD4 and CD8 T lymphocytes have significant difference (p < 0.01) between mild (Non-ICU) and severe or critical (ICU) cases (Table 3).

The levels of D-dimer, C-reactive protein and interleukin-6 were elevated (Table 1), indicating blood clot formation, severe inflammation, and cytokine storm in COVID-19 patients.